Cours IFSI Génétique 2 S1 2.2 1.2 IFSI .pdf



Nom original: Cours IFSI - Génétique 2 - S1_2.2_1.2 - IFSI.pdfTitre: S1_2.2_1.2_genetique cours 2 IFSIAuteur: G-BCH-SOMMEIL14

Ce document au format PDF 1.4 a été généré par PDFCreator Version 0.9.2 / AFPL Ghostscript 8.54, et a été envoyé sur fichier-pdf.fr le 11/10/2011 à 19:21, depuis l'adresse IP 82.124.x.x. La présente page de téléchargement du fichier a été vue 2636 fois.
Taille du document: 361 Ko (40 pages).
Confidentialité: fichier public

Aperçu du document


S1_2.2_1.2
Génétique cours 2
Bernard Grandchamp

1.Transmission des caractères (lois de Mendel)
2.liaison génétique
3.Polymorphisme
4.Cartes génétiques
5.identification des gènes

1.Transmission des caractères (lois de Mendel)

Gregor Johann Mendel, 1865

Pisum sativa

Transmission d’un caractère
Lignées parentales

F1

F2

Première loi de Mendel: transmission d’un caractère
JJ

jj

J

j
Jj

Jj

J/j
J est dominant sur j

J

j

J JJ
j Jj

Jj
jj

ségrégation de 2 caractères indépendants



En F1
Mendel observe la
disparition de 2
caractères parentaux



En F2
Mendel observe la
réapparition des 2
caractères disparus chez
6 % des descendants
(1/16)

2.liaison génétique

liaison génétique
Liaison génétique
Hérédité chromosomique

Thomas Hunt Morgan

3.Polymorphismes

Polymorphisme des Phénotypes

environnement

AGTCGGTAGCAGTAGATAATG

Polymorphisme des Génotypes

AGTCGGTAGCGGTAGATAATG

Marqueurs génétiques
• Polymorphismes de l’ADN, généralement
neutres
• Permettant de distinguer des allèles:
– SNPs (polymorphismes de substitution d’un
nucléotide)
– Microsatellites

LES MICROSATELLITES
Il s'agit de séquences d'ADN constituées de motifs répétés
de 2, 3 ou 4 nucléotides :
9 répétitions (CA)

Allèle 1
…AGCCCTCAGGCACACACACACACACACAGTTTCCAGTTGA…

Allèle 2

13 répétitions (CA)

…AGCCCTCAGGCACACACACACACACACACACACACAGTTTCCAGTTGA…

Allèle 3
11 répétitions (CA)

…AGCCCTCAGGCACACACACACACACACACACAGTTTCCAGTTGA…

LES MICROSATELLITES

Chromosome

Amorces spécifiques d’un locus

CACACACACACA

Fragments d’ADN amplifiés

1

2

3

4

5
Grands

Électrophorèse

Petits

Recombinaison meïotique

Absence de recombinaison entre A et B
Gamètes parentaux

recombinaison entre A et B
Gamètes recombinés

Analyse de ségrégation
Soit 2 marqueurs biallèliques (Aa pour M1 et Bb pour M2). Il y
a 4 combinaisons possibles de ces allèles parmi les gamètes
transmis par un individu : AB, Ab, aB et ab.
2 situations possibles :
– M1 et M2 sur des chromosomes non homologues (pas de
recombinaison possible) mais ségrégation indépendante
A

a
B

b

4 types de gamètes qui ont la même probabilité (25 %) d’être transmis

– M1 et M2 sur le même chromosome :
2 cas selon les combinaisons des allèles sur les
chromosomes de la paire (= phase)

A et B situés sur le même chromosome
(couplage)
A
B

a
b

A
B

a
b

A
b

a
B

production de 4 types de gamètes:
•gamètes parentaux (A,B et a,b)
•gamètes recombinés (A,b et a,B)
Fraction de recombinaison θ = distance génétique
Distance génétique en cM(organ)= % de gamètes recombinés

• A et B situés chacun sur les chromosomes
différents de la paire (répulsion)
A
b

a
B

A
b

a
B

A
B

a
b

• production de 4 types de gamètes:
– gamètes parentaux (A,b et a,B)
– gamètes recombinés (A,B et a,b)

locus sur des chromosomes différents
Chromosome 1

A

B

a

b

2n
n
n

Chromosome 5

méiose

A

B

A

25%

a

b
25%

b
25%

a

n

B
25%

n

Deux locus sur le même chromosome

A

B

a

b

A

B
Co

a
2n

Gamètes parentaux

n
n

A

B

b
méiose

Gamètes recombinés

A

??%

a

b
??%

b
??%

a

n

B
??%

n

Le pourcentage de gamètes
recombinées dépend de la fréquence
de recombinaison
La distance génétique entre deux
sites est dépendante de la
fréquence des crossing-over.

Trois exemples:
Indépendance génétique
Liaison génétique: 0 cM
Liaison génétique: 13 cM

Indépendance génétique

A

B
Co

a

b

Gamètes parentaux

A

B

Gamètes recombinés

A

25%

a

b
25%

b
25%

a

B
25%

Liaison génétique (0 cM)

A B
a b
Gamètes parentaux
⇒Pas de crossing overs

A B
Gamètes A B

50% ⇒Pas de gamètes recombinés (0%)

a b
Gamètes a b

⇒Distance = 0 cM
50%

Liaison génétique (13 cM)

A

B

a

b

Gamètes parentaux

A
Gamètes A B

a
Gamètes a b

B
173

b
175

Gamètes recombinés

A
Gamètes A b

a
Gamètes a B

b
28

B
24

Liaison génétique (13 cM)
n= 400
Gamètes parentaux:

AB =
ab =

173
175

Gamètes recombinés: a B = 28
A b = 24
%Rec = (28 + 24 / 400 ) X 100 = 13%

d (A, B) = 13 cM
Θ =0,13

4.Cartes génétiques

Cartographie génétique chez
l’homme: Étude de grandes familles

1- génotypage de tous les individus pour déterminer les
allèles présents pour les marqueurs étudiés chez ces
individus.
2- calcul des fréquences de recombinaison entre les marqueurs

CARTE GÉNÉTIQUE

identification des gènes
Localisation par la liaison génétique

Analyse de ségrégation
• Peut-on expliquer la manière dont la maladie
se répartit à l’intérieur des familles ?

• Peut-on mettre en évidence l’effet d’un gène
(dit « gène majeur ») et caractériser cet effet
(correspondance phénotype-génotype) ?

Analyse de liaison

Phénotype
observé

Génotype locus D(isease)
déduit
Génotype
locus M(arqueur)
observé

Liaison
Distance Génétique

Etudes de liaison: observation des méioses
dans des familles, analyse de la ségrégation de deux locus
d’une génération à la suivante

Informations obtenues:
-Existence d’une liaison entre un marqueur génétique
et un locus morbide
-Estimation de distance génétique entre un marqueur
génétique M et un locus impliqué dans une maladie D
-Recherche sur l’ensemble du génome:
pas d’hypothèse à priori sur le locus D en cause
On étudie des marqueurs répartis sur l’ensemble du génome

Le gène de la maladie: m , +
Le marqueur moléculaire rs12: 1 , 2

rs12:

rs12:

m/+
2/2

m/+
1/2

+/+
1/2

m/+
1/2

+/+
2/2

m/+
2/2

+/+
2/2

m/+
1/2

Y a t-il co-ségrégation entre les marqueurs
moléculaires et le gène de la maladie?

Le gène de la maladie: m , +
Le marqueur moléculaire rs56: 1 , 2

rs56:

rs56:

m/+

+/+

1/2

2/2

m/+

m/+

+/+

m/+

+/+

m/+

2/2

2/2

1/2

2/2

1/2

2/2

Y a t-il co-ségrégation entre les marqueurs
moléculaires et le gène de la maladie?

• Principe du maximum de vraisemblance
– on calcule la vraisemblance des observations
familiales sous différents modèles
– Vraisemblance d’une observation= probabilité
d’une observation sous l’hypothèse considérée

Succès de la génétique
« positionnelle » par étude de liaison
• 1989: identification du gène en cause dans la
mucoviscidose
• Depuis: identification des gènes dans plusieurs
centaines de maladies monogéniques
• Limites: taille des familles, hétérogénéité de locus
• Complémentarité des approches (liaison, gène
candidat, séquençage du génome)

Application diagnostique de l’analyse de liaison

m/+ +/+
1/2 2/2

rs 56

m/+
2/2

m/+
2/2

+/+
1/2

m/+
2/2

1
2

+/+
1/2

m/+
2/2

?/+
1/2

+

CO

m

Si la mutation est à 0 cM du site polymorphe rs 56 => L’enfant n’est pas porteur
de la mutation
Si la mutation est à 2 cM de rs56 => 2% de risque d’être malade


Cours IFSI - Génétique 2 - S1_2.2_1.2 - IFSI.pdf - page 1/40
 
Cours IFSI - Génétique 2 - S1_2.2_1.2 - IFSI.pdf - page 2/40
Cours IFSI - Génétique 2 - S1_2.2_1.2 - IFSI.pdf - page 3/40
Cours IFSI - Génétique 2 - S1_2.2_1.2 - IFSI.pdf - page 4/40
Cours IFSI - Génétique 2 - S1_2.2_1.2 - IFSI.pdf - page 5/40
Cours IFSI - Génétique 2 - S1_2.2_1.2 - IFSI.pdf - page 6/40
 




Télécharger le fichier (PDF)

Cours IFSI - Génétique 2 - S1_2.2_1.2 - IFSI.pdf (PDF, 361 Ko)

Télécharger
Formats alternatifs: ZIP



Documents similaires


cours 1 miacgh partie 2
glossaire
cours thierry desnos clonage positionnel
gfmom td 1 levure
livret exercices bio60 2009 10
ch3

Sur le même sujet..