Bohlooly 05 Endocrinol .pdf



Nom original: Bohlooly-05-Endocrinol.pdf

Ce document au format PDF 1.3 a été généré par XPP / , et a été envoyé sur fichier-pdf.fr le 18/11/2011 à 00:34, depuis l'adresse IP 90.9.x.x. La présente page de téléchargement du fichier a été vue 1008 fois.
Taille du document: 436 Ko (12 pages).
Confidentialité: fichier public


Aperçu du document


Growth Hormone Overexpression in the Central Nervous
System Results in Hyperphagia-Induced Obesity
Associated With Insulin Resistance and Dyslipidemia
Mohammad Bohlooly-Y,1,2,3 Bob Olsson,1,2 Carl E.G. Bruder,3 Daniel Linde´n,1,3,4 Klara Sjo¨gren,1,2
Mikael Bjursell,1,3 Emil Egecioglu,1 Lennart Svensson,3 Peter Brodin,3 John C. Waterton,5
Olle G.P. Isaksson,2 Frank Sundler,6 Bo Ahre´n,7 Claes Ohlsson,2 Jan Oscarsson,1,3,4
and Jan To¨rnell,1,2,3

It is well known that peripherally administered growth
hormone (GH) results in decreased body fat mass.
However, GH-deficient patients increase their food intake when substituted with GH, suggesting that GH also
has an appetite stimulating effect. Transgenic mice with
an overexpression of bovine GH in the central nervous
system (CNS) were created to investigate the role of
GH in CNS. This study shows that overexpression of GH
in the CNS differentiates the effect of GH on body fat
mass from that on appetite. The transgenic mice were
not GH-deficient but were obese and showed increased
food intake as well as increased hypothalamic expression of agouti-related protein and neuropeptide Y. GH
also had an acute effect on food intake following intracerebroventricular injection of C57BL/6 mice. The transgenic mice were severely hyperinsulinemic and showed
a marked hyperplasia of the islets of Langerhans. In
addition, the transgenic mice displayed alterations in
serum lipid and lipoprotein levels and hepatic gene
expression. In conclusion, GH overexpression in the
CNS results in hyperphagia-induced obesity indicating a
dual effect of GH with a central stimulation of appetite
and a peripheral lipolytic effect. Diabetes 54:51– 62,
2005

From the 1Department of Physiology, Go¨teborg University, Go¨teborg, Sweden;
the 2Department of Internal Medicine Research Centre for Endocrinology and
Metabolism, Sahlgrenska University Hospital, Go¨teborg, Sweden; 3AstraZeneca Research and Development, Mo¨lndal, Sweden; 4Wallenberg Laboratory for
Cardiovascular Research, Sahlgrenska University Hospital, Go¨teborg, Sweden; 5AstraZeneca Research and Development, Alderley Park, Macclesfield,
Cheshire, U.K.; and the Departments of 6Physiology and 7Medicine, Lund
University, Lund, Sweden.
Address correspondence and reprint requests to Mohammad Bohlooly,
Astra Zeneca Transgenics and Comparative Genomics, AstraZeneca Research
and Development, 43183 Mo¨lndal, Sweden. E-mail: mohammad.bohlooly@
astrazeneca.com.
Received for publication 23 April 2004 and accepted in revised form 28
September 2004.
AGRP, agouti-related protein; apo, apolipoprotein; bGH, bovine growth
hormone; CNS, central nervous system; GFAP, glial acid fibrillary protein; GH,
growth hormone; ICV, intracerebroventricular; MC4-R, melanocortin receptor-4; MCH, melanin-concentrating hormone; MCH-R, melanin-concentrating
hormone receptor; NPY, neuropeptide Y; POMC, proopiomelanocortin; RER,
respiratory exchange ratio.
© 2005 by the American Diabetes Association.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked “advertisement” in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.

DIABETES, VOL. 54, JANUARY 2005

I

t is well known that growth hormone (GH) decreases body fat mass in both man and experimental
animals (1– 6). Using zinc to control the metallothioneine promoter driving the ovine-GH gene, a GH
dose-dependent linear decrease in both epididymal and
subcutaneous fat pad weights was found (7). Also, in
patients with acromegaly, the body fat mass correlates
inversely with increasing GH concentrations (8). Moreover, GH-deficient adults are more obese than normal
subjects, and GH substitution decreases the fat mass in
these patients (1,9,10).
However, GH-deficient patients seem to increase their
food intake when substituted with GH, suggesting that GH
also has an appetite stimulating effect (11,12). GH has also
been shown to increase food intake in experimental
animals in some (5) but not all studies (13–16). In addition,
GH administration has been shown to change eating
behavior (16). Thus, it is not clear whether GH affects food
intake in rodents and, if so, if it is a peripheral or a central
nervous system (CNS) effect. Both GH production and GH
receptors are found in the brain. mRNA for GH can be
found in different parts of the brain (17), and the most
abundant GH immunoreactivity is found in the amygdala,
hippocampus, and hypothalamus (18). GH receptors are
also present in multiple locations in the rodent (19,20) and
human brain (21,22).
During recent years, many important findings have been
made to elucidate the complex regulation of food intake
and energy homeostasis (23–27). Intracerebroventricular
(ICV) injection of leptin decreases food intake and body
weight (28) and may be acting through the proopiomelanocortin (POMC) and leptin receptor expressing-neurones
in the hypothalamic arcuate nucleus (29). Indeed, melanocortin peptides derived from the POMC gene, especially
␣-melanocyte–stimulating hormone, are involved in the
regulation of feeding behavior (30,31). Also, agouti-related
protein (AGRP), which is expressed in the arcuate nucleus, is involved in the control of appetite by antagonizing
the melanocortin receptor-4 (MC4-R) and thereby also
leptin action (32,33). Interestingly, the expression of
AGRP is upregulated in the leptin-deficient ob/ob mice and
leptin receptor– deficient db/db mice (32,33). The spontaneous mutant yellow agouti mice are leptin resistant and
51

GH OVEREXPRESSION IN THE CNS

develop obesity with hyperleptinemia due to antagonism
of the MC4-R by ectopic expression of the agouti protein
(34,35). Whether AGRP neurons express GH receptors is
still unknown. Also, neuropeptide Y (NPY) neurones in the
arcuate nucleus are involved in energy homeostasis (36).
Chronic administration of NPY to the hypothalamus of
normal animals mimics the phenotype of leptin deficiency,
including obesity, hyperphagia, and inhibition of GH production (37), and furthermore, leptin administration reduces NPY expression (38). NPY neurons in the arcuate
nucleus have been shown to express GH receptors, while
no expression was found in NPY neurons outside the
arcuate nucleus (39). Whether the effects of GH on food
intake, as seen in GH-deficient patients, are mediated by
these central processes is not known.
We have generated a mouse model in which bovine GH
(bGH) is overexpressed in the CNS using the promoter of
glial acid fibrillary protein (GFAP). The GFAP-bGH mice
were shown to have a CNS-specific expression of bGH
(40). bGH could be detected in the serum of two lines of
GFAP-bGH mice (line 2: 207 ⫾ 21 ng/ml; line 3: 334 ⫾ 53
ng/ml, which have been used in this study), but serum
IGF-I levels were similar in GFAP-bGH mice and littermate
wild-type control mice. These findings show that the
GFAP-bGH mice are not GH-deficient in the peripheral
circulation, and that the circulating levels of bGH are
much lower than metallothionein-I transgenic mice with a
general overexpression of bGH (41). In addition, both
Mt-bGH and GFAP-bGH had threefold elevated corticosterone levels (40). In contrast to the Mt-bGH mice, the
GFAP-bGH mice did not display enhanced spontaneous
locomotor activity, indicating that this behavior involves
peripheral effects (40).
The aim of this study was to investigate the effect of
overproduction of GH in the CNS on food intake, body fat
mass, insulin sensitivity, and subsequent alterations in
lipoprotein metabolism. These are known effects of GH
(3,42– 44), but the importance of GH production in the
CNS for these effects in an animal model that is not GH
deficient is not known.
RESEARCH DESIGN AND METHODS
To generate GFAP-bGH transgenic animals, 110 injected C57 BL/6JxCBA
embryos were implanted into 5 C57 BL/6JxCBA foster mothers. Out of 22
newborn mice, 5 mice were identified as carrying the GFAP-bGH transgene
(founder animals) using Southern blot analysis (40). In this study, the founder
line with highest bGH expression in the brain (line 3) was used in most
experiments, but to confirm the GFAP-bGH phenotype, additional experiments were preformed in a second founder line (line 2) (40). The environment
of the animal room was controlled with a 12-h light-dark cycle (7:30 A.M. to
7:30 P.M., with a 1-h dawn/sunset function), a relative humidity between
45–55%, and a temperature of 20°C. The mice had free access to tap water and
standard pellet diet (R-34, Lactamin, Sweden). The study was performed after
prior approval from the local ethics committees at the Go¨teborg and Lund
Universities, Sweden. For the growth curves, five to seven mice were housed
per cage (at the age of 18 days), and the body weight was recorded every
second day up to 16 weeks of age. From that point, the body weight was
recorded once a week. At 6 –7 months of age, seven male and female
transgenic mice together with a corresponding number of littermate controls
were anesthetized with medetomidine (Domitor, Orion, Finland; 0.005 mg/10
g intraperitoneally) and ketamine (0.75 mg/10 g intraperitoneally). Serum was
obtained by heart puncture, and the organs were collected, blotted, weighed,
and immediately frozen in liquid nitrogen for further storage at ⫺135°C.
Intracerebroventricular cannulation. Normal male C57BL/6 mice were
anesthetized with initial 4% isoflurane (Baxter, Kista, Sweden) followed by a
maintenance dose of 2% isoflurane and placed in a stereotaxic frame (Stoelting, Wood Dale, IL) to implant a permanent 31-gauge stainless steel guide
52

cannula (Eicom, Kyoto, Japan) above the third ventricle (0.94 mm posterior to
the bregma, 1.0 mm below the surface of the skull). Guide cannulas were held
in position by dental cement (Heraeus Kulzer, Hannau, Germany) attached to
two stainless steel screws driven into the skull. A stainless steel obtruder
(Eicom) was inserted into the guide to maintain cannula patency. The animals
were allowed 4 days postoperative recovery. ICV injections (1 ␮l) were carried
out during a short period of anesthesia with 2% isoflurane. bGH was injected
by a stainless steel injector, inserted in and projected 1.5 mm below the tip of
the guide cannula. A 5-␮l Hamilton syringe (VWR International, Stockholm,
Sweden) was connected to a plastic tube and used for injection.
Food intake. Food was deprived from the mice 18 h before measurement of
food intake. Measurements started at 10:00 A.M. Cages (37 ⫻ 10⫺3 m2) were
prepared with normal diet and aspen chip at the bottom. They were then
incubated at 80°C for 1 h to correct for any differences in humidity. After the
cages had reached room temperature, they were accurately weighted. The
mice were weighed and immediately put in the preweighed cage with free
access to food and water. Measurement of feeding was done for 48 continuous
hours. The mice were then returned to their original cages. All excrements
were removed, and the cages were reincubated at 80°C for 1 h in order to dry
out water spill and urine, and finally reweighed at room temperature. In a
separate experiment, ad libitum–fed 3-month-old male C57BL/6 mice (randomized by body weight) were ICV injected with vehicle (Ringer, n ⫽ 4), or
bGH (0.6 ␮g, n ⫽ 5), and food intake was measured for 3 h postinjection as
described above.
Indirect calorimetry. Oxygen consumption (vO2) and carbon dioxide production (vCO2) were measured using an open circuit calorimetry system
(Oxymax; Columbus Instruments International, Columbus, OH). The animals
were placed in calorimeter chambers with ad libitum access to normal lab diet
and water for 48 h. An air sample was withdrawn for 75 s every 20 min. The
O2 and CO2 content were measured by a paramagnetic oxygen sensor and a
spectrophotometric CO2 sensor. These values were used to calculate vO2 and
vCO2. Data from the first 24 h were not used in the analysis. Data from
corresponding hours during the second 12-h light period were used in 2-h bins.
We calculated energy expenditure (kcal/h) from the following equation: (3.815
⫹ 1.232RER) ⫻ vO2, where RER is the respiratory exchange ratio (volume of
CO2 produced per volume of O2 consumed [both ml 䡠 kg–1 䡠 min–1]) and vO2 is
the volume of O2 consumed per hour per kilogram of mass of animal. The
value of metabolic rate was correlated to individual body weights. The resting
metabolism was analyzed by using the lowest value of RER during light period
and the value of metabolic rate at that exact time for calculations.
Peripheral quantitative computerized tomography. Computerized tomography was performed with the STRATEC pQCT XCT (version 5.4B; Norland
Medical Systems) operating at a resolution of 70 ␮m as previously described
(45,46). Sections were made at the same level in all mice (i.e., 5 mm proximally
of the crista iliaca).
Magnetic resonance imaging. At 6 –7 months of age, four male GFAP-bGH
transgenic mice and five male littermate controls were killed. We used a
magnetic resonance imaging system (Varian, Palo Alto, CA) incorporating a
4.7 T magnet (Oxford Instruments, Oxford, U.K.) and pulsed field gradients
capable of 200 mT m⫺1 with a rise time of 0.3 ms. A quadrature birdcage
radiofrequency transceiver with 103-mm internal diameter with sufficient
radiofrequency homogeneity to encompass the entire cadaver was used.
Image acquisition used a multislice two-dimensional spin-echo technique
(TR ⫽ 5 s; TE ⫽ 11 ms; 41 contiguous transverse slices; 2-mm slice thickness;
matrix 128 ⫻ 128; field of view 50 mm ⫻ 50 mm ⫻ 82 mm). Both fat (C1H2 and
C1H3)- and water (1H2O)-suppressed magnetic resonance images were obtained. This image matrix included the entire animal. Two phantoms were also
included in the image field. These were two 4.2-mm inner diameter tubes
containing water and olive oil. The fat- and water-suppressed images were
obtained by applying a Gaussian saturation pulse applied on the fat and water
resonances.
Image analysis. Segmentation was performed manually using software
written in-house in interface definition language (Research Systems, Boulder,
CO). Segmentations of both subcutaneous adipose tissue and abdominal/
thoracic adipose tissue were obtained from the water-suppressed images. The
segmentations were performed from the cranial end of the thoracic cavity to
the caudal end of the abdomen. Thus, the body was included but limbs and
head excluded from the segmentation. The subcutaneous adipose tissue in
this region was defined as adipose tissue present outside the abdominal and
thoracic cavities. The volumes were computed using programs written
in-house in interface definition language. The segmented regions were subsequently surface rendered to produce three-dimensional representations of the
visceral and subcutaneous adipose tissues. Brown fat was identified from
signal intensity.
Magnetic resonance spectroscopy. Magnetic resonance spectra were also
obtained without the phantoms present using the same coil. Eight averages
DIABETES, VOL. 54, JANUARY 2005

M. BOHLOOLY AND ASSOCIATES

were acquired, and the repetition time was 17 s. Tissue water was used as an
internal reference at a chemical shift of 4.8 ppm. Spectra were integrated
using VNMR software (Varian, Palo Alto, CA). The integrals of the water signal
(I3.5– 6.5: signal between 3.5 and 6.5 ppm) and the CH2 and CH3 signals from fat
(I0 –3: signal between 0 and 3 ppm), in arbitrary units, were converted to
estimated mass, in grams, using the simplifying assumption that mice are
composed entirely of water (mw 18, 2/2 protons resonate between 3.5 and 6.5
ppm) and tripalmitin (mw 807, 93/98 protons resonate between 3.5 and 6.5
ppm), using the equation below.
I0 –3 ⫻ 807/93
estimated mass of fat
/g ⫽
⫻ mouse mass/g
(astripalmitin)
(I3.5– 6.5 ⫻ 18/2) ⫹ (I0 –3 ⫻ 807/98)
Total cholesterol, triglycerides, lipoprotein size distribution, and hepatic lipid content. Total serum cholesterol and triglycerides were measured
with enzymatic colorimetric assays (Chl/CHOD-PAP and TG/GPO-PAP; Roche
Diagnostics, Mannheim, Germany). Serum apolipoprotein (apo)B was measured by an electroimmunoassay as previously described (3,47). The cholesterol distribution profiles were measured using a size exclusion high
performance liquid chromatography system, SMART, with column Superose 6
PC 3.2/30, (Amersham Pharmacia Biotech, Uppsala, Sweden) as described
before (48). The lipoproteins in a 10-␮l sample were separated within 60 min,
and the areas under the curve represents the cholesterol content.
Frozen livers were homogenized in isopropanol (1 ml/50 mg tissue) and
incubated at 4°C for 1 h. The samples were centrifuged in 4°C for 5 min at
2,500 rpm, and the triglyceride concentration in the supernatant was measured as described above.
Western blot. Western blotting to detect LDL receptor expression was
performed as described before (48) using enhanced chemiluminescence
protocol (Amersham Pharmacia Biotech, Buckinghamshire, U.K.) and quantified using Fluor-S Multi Imager and Quantity One software (Bio-Rad, Hercules,
CA). In brief, 30 ␮g of protein were separated and transferred under
nonreducing conditions. Primary rabbit anti-bovine LDL receptor antibody (a
generous gift from Professor Joacim Herz, Department of Molecular Genetics,
University of Texas, Dallas, TX) and secondary horseradish peroxidase–linked
donkey anti-rabbit Ig were both diluted 1:2,000 in blocking buffer.
Intravenous glucose tolerance test. Intravenous glucose tolerance test
was performed in 6- to 7-month-old nonfasted mice and repeated in 9-monthold fasted mice. The animals were anesthetized with an intraperitoneal
injection of midazolam (Dormicum; Hoffman-La-Roche, Basel, Switzerland;
0.14 mg/mouse) and a combination of fluanison (0.9 mg/mouse) and fentanyl
(0.02 mg/mouse; Hypnorm, Janssen, Belgium). Thereafter, a blood sample was
taken from the retrobulbar capillary plexus after which the animals were
given an intravenous injection of D-glucose (1 g/kg; British Drug Houses,
Poole, U.K.). The volume load was 10 ␮l/g body wt. Blood was sampled after
1, 5, 10, 20, 30, and 50 min (75 ␮l per sample). The samples for glucose and
insulin were taken in heparinized tubes, and after immediate centrifugation,
plasma was separated and stored at 80°C until analysis.
Immunohistochemistery. Pancreata of adult and embryonic (E19) mice
were immersed overnight in Stefanini’s fixative (2% formaldehyde and 2%
picric acid in phosphate buffer, pH 7.2) and further rinsed repeatedly in
sucrose-enriched (10%) buffer, frozen on dry ice, and stored at ⫺70°C.
Sections were cut at 10 ␮m thickness in a cryostat and mounted on
chrome-alum– coated slides. Indirect immunofluorescence on cryostat sections was used for immunohistochemical demonstration of proinsulin and
glucagon. Details of the antibodies and methods are previously described (49).
For each hormone, five sections taken at different levels of each pancreas
(n ⫽ 6) were examined.
Analysis of hormones and glucose in serum/plasma. Serum leptin levels
were measured by an ELISA assay (Chrystal Chemicals, Downers Grove, IL).
Plasma insulin was determined radioimmunochemically with the use of a
guinea pig anti-rat insulin antibody, 125I-labeled human insulin as tracer, and
rat insulin as standard (Linco Research, St. Charles, MO). Plasma corticosterone levels were determined with a radioimmunoassay (RPA 548) from
Amersham Life Science (U.K.). Plasma glucose was determined with the
glucose oxidase method (50).
Genome-wide expression analysis. Livers from six transgenic male animals
and six wild-type male controls (6 –7 months old) were dissected. Approximately 100-mg sections were homogenized, and RNA was prepared using
TRIzol reagent (Invitrogen LifeTechnologies, Carlsbad, CA) according to
provided protocol. Two duplicate cDNA syntheses were done followed by
cRNA labeling and finally hybridization against the MG-U74Av2 mouse genome chip from Affymetrix (Santa Clara, CA) using protocols supplied by the
manufacturer. Washing and staining were done with a Fluidics Station 400
using the EukGE-WS2 protocol (Affymetrix). The chips were then directly
scanned twice using a GeneArray scanner.
The signal intensity analysis of the arrays was done using the Microarray
DIABETES, VOL. 54, JANUARY 2005

suite 5.0 from Affymetrix. The intensities were scaled using a target signal
factor of 150. The intensity file from each array was then imported into
GeneSpring 4.2.1 for further analysis (Silicon Genetics, Redwood City, CA).
Initially, genes that were scored as absent on at least 22 of 24 arrays were
sorted out. We then filtered out genes with statistically significant differences
when grouped by genotype (GFAP-bGH or wild type) using a parametric test
without the assumption of equality of variance (Welch ANOVA) with a P value
cutoff set to 0.05. This analysis was followed by multiple testing correction
analysis. We used the Benjamini and Hochberg test, which controls the false
discovery rate defined as the proportion of genes expected to be identified by
chance relative to the total number of genes called significant. Genes with
significant changes of expressions between the transgenic group and the
wild-type group were further filtered using a ratio of ⫾1.25 (25%) or ⫾2 (100%)
as threshold. These genes were then sorted according to function, protein
family, or metabolic pathway.
Real-time PCR. Hypothalami from six transgenic males, five transgenic
females, and seven control mice (6 –7 months old) from each sex were
dissected. Total RNA was extracted by Tri Reagent (Sigma Aldrich St. Louis,
MO, USA). First-strand cDNA was synthesized from total RNA using Superscript preamplification system (Invitrogen LifeTechnologies, Carlsbad, CA).
Real-time PCR analysis was performed with an ABI Prism 7700 Sequence
Detection System (Applied Biosystems, Foster City, CA) using FAM-, VIC-, and
TAMRA-labeled fluorogenic probes. The expression data were normalized
against mouse acidic ribosomal phosphoprotein P0 (M36B4). The relative
expression levels were calculated according to the formula 2⫺⌬CT, where ⌬CT is
the difference in cycle threshold values between the target and the M36B4 internal
control. Sequences for the primers and probes are presented in Table 1.
Statistics. Comparisons between two groups were made by unpaired Student’s t test. Two-way ANOVA was used to analyze glucose tolerance test and
weight change in the transgenic mice and their controls. Welsh ANOVA
followed by Benjamini and Hochberg false discovery rate test was used to
analyze the DNA array data. Values are presented as mean ⫾ SE. P ⬍ 0.05 was
considered significant.

RESULTS

Body weight. The generation of GFAP-bGH animals was
previously described (40). To investigate the relationship
between GH overexpression in the CNS and postnatal
growth, the body weights of the GFAP-bGH line with
highest GH expression (line 3) and control littermates
were followed in more detail. A difference in weight was
seen in female mice at ⬃20 –25 days of age, when the
transgenic females gained more weight than controls. A
weight difference between transgenic male mice and male
controls was detected at 55– 60 days of age (male P ⬍ 0.01
and female P ⬍ 0.001, n ⫽ 7–12) (Fig. 1A). At 130 days (18
weeks) of age, transgenic females were 31% (P ⬍ 0.05)
heavier and transgenic males 19% (P ⬍ 0.05) heavier than
their littermate controls. Similar results were seen in a
second GFAP-bGH transgenic line (line 2) derived from a
different founder. At 130 days (18 weeks) of age, the
transgenic females from this founder line were 42% (P ⬍
0.001) heavier than their littermate controls (GFAP-bGH
38.6 ⫾ 1.8 g vs. wild type 27.1 ⫾ 1.4 g), confirming an
increased body weight as a result of overexpression of
bGH in the CNS.
Body fat mass. To investigate whether the increased body
weight in GFAP-bGH mice was accompanied with an
altered body composition, abdominal computer tomography scans were performed in vivo. Interestingly, both the
visceral and subcutaneous fat deposits were increased in
the GFAP-bGH mice compared with the control mice
when they were 6 months old (Fig. 1B). The body composition was also analyzed in vivo using MR spectroscopy
(Fig. 1C). The integrals of the water signal and the CH2 ⫹
CH3 signal from fat measured from the nuclear magnetic
resonance spectra showed a 100% increase in fat integral/
arbitrary units (GFAP-bGH 31.3 ⫾ 0.8 units vs. wild type
53

54

The expression of AGRP and MCH-R were detected using SYBR Green I dye, whereas all other transcripts were detected using Taqman probes labelled with FAM in the 5⬘ end and TAMRA
in the 3⬘ end.

None
TCGGTCTCTTCGACTAATCCCGCCAA
ATGGCCTCTCTCTATGTCCACATGTTCCTGA
TCCTTCCTATGGGAAATTTAGCTGAGTTTTCTTCAT
None
CCTCTGCTGGCGCGTCCTCG
AGCGCTCCTACTCCATGGAGCACTTCCGCTG
GACTCGTGCAGCCTTACACAG
AAGCAGGCTGACTTGGTTGC
ATCCTCTTAATGTGAAGCCTCGC
AGCATACACCTGAGCATGTCAAAT
CAACACCAAGCGTTTTCGAA
GAGCGGAGTAGTATCTGGCCAT
TCCCTCTTGAACTCTAGGGGAAA
TTGGCGGAGGTGCTAGATC
GAGGAATCAGATGAGGATATGGGA
CGCTGTCATCATCTGCCTCAT
GAATGGAGTTCAGAATACTGAGTCCA
TCAGCTTGGGCTATGCTAACAG
CTCCAAGCCGGACAATCC
CGCAGAGGCGTGCGGAGGAAGA
AGRP
M36B4
MC4-R
MCH
MCH-R
NPY
POMC

Primer 2
Primer 1
Gene

TABLE 1
Primer and probe sequences (5⬘ to 3⬘) for real-time quantitative PCR/Taqman analysis

Probe

GH OVEREXPRESSION IN THE CNS

15.7 ⫾ 1.7 units; P ⬍ 0.01 Student’s t test), a 152% increase
in estimated mass of fat in gram (GFAP-bGH 16.2 ⫾ 0.3 g
vs. wild type 6.4 ⫾ 0.9 g; P ⬍ 0.01, Student’s t test), and a
101% increase in estimated mass proportion of fat per
mouse (GFAP-bGH 30.5 ⫾ 0.9% vs. wild type 15.2 ⫾ 1,7%;
P ⬍ 0.01, Student’s t test) in GFAP-bGH mice compared
with control mice. Segmentation volumes of the abdominal/thoracic compartment, measured using magnetic resonance imaging, showed a 159% increase in total adipose
volume/ml (GFAP-bGH 10.3 ⫾ 0.5 volume/ml vs. wild type
4.0 ⫾ 0.4 volume/ml; P ⬍ 0.01, Student’s t test), a 169%
increase in subcutaneous adipose volume/ml, a 146% increase in visceral adipose volume/ml, and a 123% increase
in interscapular brown fat pad/ml (n ⫽ 4 –5; Fig. 1C).
Dissection of fat depots confirmed that the GFAP-bGH
mice were obese. The absolute as well as the relative
weights (in percentage of body weight) of dissected retroperitoneal, reproductive, and brown adipose tissue depots
were markedly increased in both male and female GFAPbGH mice compared with wild-type littermate controls
(Table 2). Similar results on adipose tissue weights were
found in a second GFAP-bGH transgenic line (line 2)
derived from a different founder. The absolute as well as
the relative weights of dissected retroperitoneal (GFAPbGH 0.41 ⫾ 0.02 g vs. wild type 0.21 ⫾ 0.03 g, P ⬍ 0.01 and
GFAP-bGH 1.0 ⫾ 0.04% bw vs. wild type 0.8 ⫾ 0.07% bw,
P ⬍ 0.05, Student’s t test) and reproductive (GFAP-bGH
3.4 ⫾ 0.15 g vs. wild type 1.4 ⫾ 0.3 g, P ⬍ 0.01 and
GFAP-bGH 9.0 ⫾ 0.7% bw vs. wild type 5.0 ⫾ 0.9% bw, P ⬍
0.05, Student’s t test) adipose tissue depots were markedly
increased in females of this second line of GFAP-bGH
mice compared with their wild-type littermate controls,
confirming the obese phenotype of GFAP-bGH mice.
In addition, the weights of several other organs, including brain, spleen, heart, kidney, lung, testis, and liver, were
changed in absolute or relative terms in the transgenic
mice (Table 2). Leptin levels have been shown to correlate
to the amount of fat (51,52), and as expected, serum levels
of leptin were increased in both female (⫹58%) and male
(⫹44%) GFAP-bGH mice compared with littermate controls (Fig. 1D).
Food intake and indirect calorimetry. To test the
possibility that the difference in weight gain between
GFAP-bGH transgenic mice and wild-type mice could be
due to a difference in food intake, we measured the food
intake over 48 h after an 18-h fasting period in male
GFAP-bGH mice and littermate male controls. During the
fasting period, there was no difference in weight loss
between the GFAP-bGH transgenic and wild-type mice
(P ⫽ 0.8; data not shown). GFAP-bGH mice had increased
accumulated food intake (⫹60%; P ⬍ 0.0001) and relative
food intake (⫹32%; P ⬍ 0.05) compared with wild-type
littermate controls (Fig. 2A and B). Using indirect calorimetry, no significant changes in RER or energy expenditure
were observed between GFAP-bGH mice and wild-type
littermate controls (Fig. 2, C and D).
A single ICV injection of dexamethasone has been
shown to increase food intake in adrenalectomized obese
leptin-deficient ob/ob mice (53). Thus, the increased food
intake in GFAP-bGH mice could be due to the increased
serum corticosterone levels found in these mice (40). To
investigate whether GH has a direct effect in the CNS on
DIABETES, VOL. 54, JANUARY 2005

M. BOHLOOLY AND ASSOCIATES

FIG. 1. GFAP-bGH mice are obese. Body
weight gain (A) in GFAP-bGH transgenic mice (Tg) and littermate wildtype
mice
(Wt).
Representative
abdominal CT scan of a female GFAPbGH mouse and corresponding wildtype mouse is shown. CT sections were
made at the same level in both mice
(i.e., 5 mm cranially of the crista iliaca).
The black arrows indicate the peritoneum (B). An example of surface-rendered MR images of subcutaneous and
visceral fat in male mice and segmentation volumes of the abdominal/thoracic
compartment of subcutaneous adipose,
visceral adipose, and interscapular
brown adipose using magnetic resonance imaging is shown (n ⴝ 4 –5) (C).
Serum leptin levels (D). Littermates at
the age of 6 –7 months were used (B–D).
Values are means ⴞ SE (n ⴝ 7–12). *P <
0.05 and **P < 0.01 vs. wild type (Student’s t test). Growth curves data were
analyzed using two-way ANOVA using
genotype and time as factors.

food intake, a separate experiment was conducted where
food intake was measured following ICV injection of bGH
in ad libitum–fed C57BL/6 mice (Fig. 2E). ICV injection of
bGH increased food intake (⫹46%; P ⬍ 0.05). In addition,
no change in serum corticosterone level was observed in
the bGH-treated mice compared with vehicle-treated animals (bGH [n ⫽ 5] 219.3 ⫾ 25.8 ng/ml vs. vehicle [n ⫽ 4]
232.8 ⫾ 13.7 ng/ml; P ⫽ 0.68, Student’s t test).
Hypothalamic gene expression. Several hypothalamic
genes, known to regulate food intake, were measured to
determine the mechanism behind the increased food intake in GFAP-bGH mice. The hypothalamic AGRP mRNA
levels were increased by more than twofold in both female
and male transgenic mice compared with wild-type mice
(Fig. 2F). Furthermore, NPY mRNA levels were significantly increased in female GFAP-bGH transgenic mice
(Fig. 2G). In contrast, the hypothalamic mRNA levels of
POMC, melanin-concentrating hormone (MCH), melaninconcentrating hormone receptor (MCH-R), and MC4-R
were not significantly different between control mice and
GFAP-bGH transgenic mice (data not shown).
Glucose tolerance. GFAP-bGH transgenic mice at 6 –7
months of age had severely increased basal insulin levels
compared with littermate controls (Fig. 3A). Furthermore,
this was also observed during a glucose tolerance test
where the insulin levels of the GFAP-bGH transgenic mice
were markedly higher at each time point (P ⬍ 0.001, n ⫽
6) (Fig. 3B). However, there was no difference in the basal
glucose levels or glucose tolerance between the transgenic
DIABETES, VOL. 54, JANUARY 2005

mice and littermate controls (P ⫽ 0.12). Similar results
were observed when these mice were 9 months old (data
not shown).
Islet morphology. Because the GFAP-bGH mice were
hyperinsulinemic, we investigated whether this was reflected in the morphology of the pancreatic islets. Pancreatic sections from GFAP-bGH transgenic mice and
littermate controls were examined by immunohistochemistry with proinsulin and glucagon antibodies. A marked
islet hyperplasia was observed in the pancreas from
GFAP-bGH mice, and the islet architecture was disturbed
with an ␣-cell disorganization (Fig. 3C). Thus, in GFAPbGH transgenic mice, glucagon cells were regularly observed in the central portion of the islets, whereas in the
littermates, the normal mantle zone of ␣-cells was observed. In the embryonic pancreas (stage E19 examined),
cords and clusters of proinsulin and glucagon immunoreactive cells were seen, with no distinct formation of
mantle-type islets in either transgenic or littermate controls. Furthermore, there was no overt difference in the
amount of endocrine tissue between the two genotypes at
this developmental stage (not shown).
Serum lipoproteins. To investigate whether the alterations in body composition and insulin sensitivity were
accompanied by changes in serum lipoprotein levels, total
serum levels of cholesterol and triglycerides as well as
serum lipoprotein profiles at 6 months of age were measured. The effects were similar in male and female mice;
therefore, only data from male mice are given in Fig. 4A–E.
55

GH OVEREXPRESSION IN THE CNS

TABLE 2
The effect of brain-specific bGH overexpression on body and organ weight

Body (g)
Brain (hypothalamus)
Heart
Liver
Kidney
Spleen
Lung
Testis
Retroperitoneal
adipose tissue
Reproductive adipose
tissue
Brown adipose tissue

Females

Absolut weight
(mg)

Relative
weight
(% body wt)

Males

Absolut weight
(mg)

Relative
weight
(% body wt)

Tg
Wt
Tg
Wt
Tg
Wt
Tg
Wt
Tg
Wt
Tg
Wt
Tg
Wt
Tg
Wt

47 ⫾ 2*
37 ⫾ 2
504 ⫾ 5†
479 ⫾ 3
173 ⫾ 5†
137 ⫾ 6
948 ⫾ 111*
1487 ⫾ 179
328 ⫾ 14
297 ⫾ 8
125 ⫾ 7
107 ⫾ 9
164 ⫾ 4
160 ⫾ 3





1.07 ⫾ 0.04*
1.31 ⫾ 0.07
0.37 ⫾ 0.01
0.37 ⫾ 0.02
4.1 ⫾ 0.14
3.92 ⫾ 0.22
0.7 ⫾ 0.03
0.81 ⫾ 0.05
0.26 ⫾ 0.01
0.3 ⫾ 0.04
0.35 ⫾ 0.01*
0.44 ⫾ 0.03



Tg
Wt
Tg
Wt
Tg
Wt
Tg
Wt
Tg
Wt
Tg
Wt
Tg
Wt
Tg
Wt

51 ⫾ 2†
42 ⫾ 2
508 ⫾ 6*
479 ⫾ 8
214 ⫾ 10*
181 ⫾ 9
2716 ⫾ 234*
1897 ⫾ 197
471 ⫾ 29
471 ⫾ 8
163 ⫾ 12†
96 ⫾ 3
204 ⫾ 4*
184 ⫾ 5
215 ⫾ 11
218 ⫾ 9



1.01 ⫾ 0.04*
1.16 ⫾ 0.04
0.42 ⫾ 0.02
0.44 ⫾ 0.02
5.34 ⫾ 0.34
4.52 ⫾ 0.3
0.93 ⫾ 0.03†
1.14 ⫾ 0.04
0.32 ⫾ 0.02†
0.23 ⫾ 0.01
0.41 ⫾ 0.01
0.45 ⫾ 0.02
0.43 ⫾ 0.02*
0.53 ⫾ 0.02

Tg
Wt

963 ⫾ 75†
519 ⫾ 58

2.02 ⫾ 0.08†
1.37 ⫾ 0.08

Tg
Wt

929 ⫾ 69†
503 ⫾ 47

1.85 ⫾ 0.15†
1.21 ⫾ 0.1

Tg
Wt
Tg
Wt

6430 ⫾ 507†
3701 ⫾ 562
462 ⫾ 34†
192 ⫾ 29

13.49 ⫾ 0.74†
9.62 ⫾ 0.78
0.98 ⫾ 0.07†
0.5 ⫾ 0.04

Tg
Wt
Tg
Wt

2772 ⫾ 230†
1738 ⫾ 158
408 ⫾ 17†
231 ⫾ 18

5.5 ⫾ 0.44*
4.16 ⫾ 0.31
0.81 ⫾ 0.03†
0.56 ⫾ 0.04

Data are means ⫾ SE. Adipose tissue, “reproductive” refers to the epididymal or parametrial adipose tissue of male and female mice,
respectively. Wild-type (Wt) males (n ⫽ 7) and GFAP-bGH transgenic (Tg) males (n ⫽ 7) were compared and wild-type female mice (n ⫽
7), and GFAP-bGH transgenic females (n ⫽ 7) were compared separately. Littermates at the age of 6 –7 months were used. *P ⬍ 0.05 and
†P ⬍ 0.01 vs. corresponding littermate controls (unpaired Student’s t test).

Serum cholesterol levels were higher in both male and
female transgenic mice by 49 and 89%, respectively, while
the serum levels of triglycerides were 52 and 43% lower in
transgenic males and females, respectively, compared
with wild-type gender littermate controls (Fig. 4, A and B
and data not shown). The hepatic triglyceride content was
not different between the GFAP-bGH mice and gender
littermate controls (data not shown).
Serum apoB levels were lower in the transgenic male
mice compared with wild-type mice (Fig. 4C). The serum
lipoprotein profiles showed a change in the size-distribution profile in the transgenic mice that was similar in male
(Fig. 4E) and female mice (data not shown). The sizedistribution profiles indicated that the transgenic mice had
increased serum levels of small LDL or large HDL particles. The lower serum apoB levels in the transgenic mice
indicate that the changed size-distribution profiles of lipoproteins are explained by higher serum levels of large
HDL particles. To investigate whether the decreased serum levels of apoB could be due to an increased expression of the LDL receptor, the hepatic LDL receptor protein
expression was determined with Western blot (Fig. 4D).
Both the 130-kDa and the 220- to 240-kDa band (corresponding to a dimer of the LDL receptor) (54) were
quantified and added to a total expression value. The LDL
receptor protein levels did not differ between the transgenic mice and the wild-type controls (P ⫽ 0.1) (Fig. 4D),
indicating that the lower apoB levels in the transgenic
mice are not a result of an increased LDL receptor
expression.
56

Genome-wide expression analysis of the liver. To
bring further understanding to the metabolic changes in
the liver introduced by the overexpression of bGH in the
CNS, we performed gene expression analysis of livers
from six transgenic and six wild-type male mice using the
Affymetrix MG-u74Av2 chip. Applying the statistical restrictions mentioned in RESEARCH DESIGN AND METHODS, we
filtered out 781 genes and expressed sequence tags with an
up or downregulation ⬎25% (1.25⫻ fold change). Using an
expression ratio change of 100% (twofold) or more resulted in 176 genes being differentially expressed between
GFAP-bGH mice and littermate controls. Further selection
was done using the Incyte hierarchies of protein function
and enzymes as well as the enzyme commission number.
In Table 3, the difference in gene expression between
GFAP-bGH transgenic mice and littermate controls is
given with respect to genes involved in metabolism as well
as genes dependent on the sexually dimorphic secretory
pattern of growth hormone (55–58). No effect on IGF1mRNA but increased GH receptor mRNA expression was
observed (Table 3). In short, most of the other changes in
gene expression in male GFAP-bGH mice could be solely
attributed to a more continuous secretion of bGH as a
result of leakage of GH from the CNS (40). These genes are
exemplified by the prolactin receptor, major urinary proteins, and carbonic anhydrase III (Table 3). In addition, a
few other genes involved in different metabolic pathways
were also differentially expressed and further discussed
below.
DIABETES, VOL. 54, JANUARY 2005

M. BOHLOOLY AND ASSOCIATES

FIG. 2. GFAP-bGH mice have increased
food consumption. The average food intake
over 48 h was calculated by measuring individual food intake of GFAP-bGH (Tg) and
wild-type (Wt) mice (n ⴝ 7– 8) (A). Food
intake was also related to individual body
weights (B). Calculations of RER were
based on the lowest value during resting
light phase for each individual mouse (n ⴝ
8) (C). The energy expenditure, measured
during light resting phase, was correlated
to individual body weights (n ⴝ 8) (D). The
acute effect of GH in the CNS on average
food intake over 3 h was measured in individual mice following ICV injection of bGH
(n ⴝ 5) or vehicle (Ringer; n ⴝ 4) in normal
3-month-old male C57Bl/6 mice (E). Gene
expression levels of the hypothalamic
genes AGRP (F) and NPY (G) in GFAP-bGH
and wild-type males and females. The
mRNA levels were measured with real-time
PCR and related to the internal control,
M36B4 (n ⴝ 5–7). Littermates at the age of
6 –7 months were used (A–D, F and G).
Values are means ⴞ SE. *P < 0.05, **P <
0.01, and ***P <0.001 vs. wild type (Student’s t test).

DISCUSSION

In this study, we demonstrate that overexpression of GH in
the CNS results in hyperphagia-induced obesity. The increased food intake was associated with a marked increase in AGRP and a slight increase in NPY levels in the
hypothalamus. GFAP-bGH mice also had elevated serum
insulin and cholesterol levels. In spite of the insulin
resistance, they had normal glucose tolerance because
they exhibited an adequate and exaggerated insulin response. Thus, GH overexpression in the CNS results in
changed glucose and lipid metabolism.
The increased leptin levels in the GFAP-bGH mice,
together with the increased food intake, indicate an impaired hypothalamic response to leptin, which is further
supported by a clear upregulation of hypothalamic AGRP
mRNA levels. AGRP is known to functionally antagonize
leptin action in the hypothalamus (32,33). NPY mRNA
levels were slightly elevated in female GFAP-bGH mice,
which also indicates decreased leptin action. These results
support that increased levels of GH in the CNS induce
alteration in the hypothalamic systems controlling satiety
DIABETES, VOL. 54, JANUARY 2005

and orexic behavior. In line with our findings, hypophysectomy of rats significantly decreased NPY mRNA levels in the
arcuate nucleus, and GH treatment restored these levels to
those of intact rats (39). We could not detect any significant
changes in the expression of MC4-R, MCH, MCH-R, and
POMC, indicating that the alterations in gene expression of
peptides involved in appetite control are specific and limited
to only certain peptides. Therefore, CNS-acting GH may
stimulate appetite by increasing AGRP expression. Similarly,
rats injected intracerebroventricularly with the endogenous
GH secretagogue, ghrelin also develop hyperphagia-induced
obesity, which is suggested to be mediated via an induction
of AGRP and NPY (59,60). Thus, one may speculate that the
effects of ghrelin on feeding behavior could involve downstream local GH signaling in the CNS. However, ICV injections of ghrelin increased food intake in GH-deficient rats
(60), arguing that ghrelin can have GH-independent effects on
food intake.
Berryman et al. have shown that mice with a general
overexpression of GH have unchanged relative food intake
(13). This finding is in accordance with our own Mt-bGH
57

GH OVEREXPRESSION IN THE CNS

FIG. 3. GFAP-bGH mice are insulin resistant. Basal insulin levels in GFAP-bGH mice (Tg) and wild-type mice (Wt) are shown (A). Serum insulin
and glucose levels were measured before and 1, 5, 10, 20, 30, and 50 min after intravenous injection of glucose (1g/kg) in male mice (B). Pancreatic
islet morphology and proinsulin and glucagon immunoreactivity in male GFAP-bGH and wild-type mice as studied by immunohistochemistry are
shown (C). Littermates at the age of 6 –7 months were used. Values are means ⴞ SE (n ⴝ 7). *P < 0.05 and **P < 0.01 vs. wild type (Student’s
t test). The glucose tolerance test was analyzed by two-way ANOVA using genotype and time as factors.

mice (60a). The reason for the different effect of general
GH overexpression versus CNS-specific overexpression of
GH on food intake is unclear. We show in this study that
GH has an acute effect on food intake following an ICV
injection. Thus, the local GH concentration in the CNS
may be different between GFAP-bGH and Mt-bGH mice, or
peripheral effect(s) may counteract the CNS effect of GH
on food intake.
In two other studies overexpressing human GH in the
cerebral cortex and hypothalamus, respectively, the mice
were shown to exhibit a dwarf phenotype (61,62). These
mice showed reduced GH and IGF-I mRNA levels in the
pituitary and liver, respectively, and circulating levels of
IGF-I (61,62), suggesting that the growth retardation in
these mice is due to disruption of mouse GH synthesis and
release from the pituitary. Other groups have reported
obesity after expressing GH and GH-releasing hormone in
the CNS, which also has been attributed to lowering of
endogenous GH levels (63,64), because GH deficiency
leads to increased fat depots in man and experimental
animals (6,9,10,65). In our model, however, the serum
levels of GH were not reduced. In fact, both lines of
GFAP-bGH mice used in this study had a leakage of bGH
produced in the CNS to the circulation (40). Interestingly,
we found that the hepatic gene expression of the GH
receptor was increased in the transgenic mice, but no
change in IGF-1 mRNA was observed, indicating that the
total GH secretion is not markedly changed in these
animals. The liver expression profile in GFAP-bGH mice is
somewhat similar to that observed in Mt-bGH transgenic
male mice (66) with respect to the effect on the GH
receptor mRNA and the genes that are regulated by the
sexually dimorphic secretory pattern of GH as exemplified
by carbonic anhydrase III. However, most of the changes
observed in Mt-bGH mice with respect to regulation of
58

genes involved in lipid and carbohydrate metabolism are
not observed in the GFAP-bGH mice (66). Together, these
results indicate a change from pulsatile to continuous
secretion of GH in male mice as indicated by the change in
gene expression of the prolactin receptor, testosterone
16-␣ hydroxylase, 3-ketosteroid reductase, major urinary
proteins, and carbonic anhydrase III (55–58,67). Thus, the
changed plasma pattern of GH seems to feminize the
hepatic gene expression of male mice. However, in terms
of obesity, insulin resistance, and serum lipoproteins, we
did not observe different effects in males and females.
Therefore, the possibility of feminization of the male liver
gene expression did not have any impact on our major
findings regarding the phenotype of these mice. Moreover,
we can conclude from the results of measurements of
circulating bGH in the two lines of GFAP-bGH mice (40)
and the gene expression data that there may be a small
increase in peripheral GH but no GH deficiency.
It is well known that insulin resistance is linked to
obesity in man and experimental animals (68,69). In spite
of the marked hyperinsulinemia that reached levels similar
to those seen in the severely insulin-resistant ob/ob mouse,
GFAP-bGH mice did not develop type 2 diabetes during
the observation period. Indeed, fasting glucose levels were
normal and so was glucose elimination during a glucose
tolerance test. This suggests that the islet response to
glucose challenge is adequate for the ambient insulin
resistance, fully compensating for the reduced insulin
action.
The islet morphology revealed a marked hyperplasia of
the pancreatic islets, which is expected following a longstanding insulin resistance. An interesting observation was
the disturbance in islet cytoarchitecture, in which the
␣-cells were disorganized and partially dispersed among
the centrally located ␤-cells. A similarly disturbed cytoarDIABETES, VOL. 54, JANUARY 2005

M. BOHLOOLY AND ASSOCIATES

chitecture has been observed in several genetic mouse
models of insulin resistance and hyperinsulinemia and is
thought to be one manifestation of a type 2 diabetes
phenotype (70,71). At the embryonic stage examined
(E19), the amount of endocrine cells in the pancreas did
not differ between the transgenic mice and littermate
controls. Therefore, the islet hyperplasia seems to commence postnatally, as do the islet cytoarchitecture
changes, possibly in response to the hyperphagia-induced
obesity.
The transgenic mice showed a decreased level of gene
expression of hepatic lipase and scavenger receptor class
type I, which may indicate decreased turnover of HDL
(72). ApoC-II is an important lipoprotein lipase activator.
An upregulation of apoC-II may result in increased turnover of triglyceride-rich lipoproteins, leading to decreased
triglyceride and apoB levels. Moreover, the mRNA level for
the enzyme responsible for apoB mRNA editing, apobec-1,
was increased. This finding indicates increased editing of
apoB mRNA and therefore a decreased production of
apoB 100 (73). Because apoB 48 – containing lipoproteins
have a higher turnover than apoB 100, this finding may
help to explain the lower apoB levels in the GFAP-bGH
mice. The observed increase in lecithin cholesterol acyltransferase gene expression together with the possibility
of increased turnover of triglyceride-rich lipoproteins may
contribute to increased production of HDL cholesterol in
the transgenic animals. Thus, both increased production

and decreased turnover of HDL may help to explain the
changed lipoprotein profile in these mice.
We have previously shown that the GFAP-bGH mice
used in this study have threefold elevated corticosterone
levels compared with wild-type animals (40). Glucocorticoid treatment has been shown to increase food intake in
humans (74) and mice (53) and promote fat accumulation
and insulin resistance in mice (75,76). These effects could
possibly be due to an increased hypothalamic AGRP and
NPY expression (77). It is therefore possible that the
increased food intake observed in GFAP-bGH mice is at
least partly due to increased serum levels of corticosterone (40). However, Mt-bGH mice with similarly increased
corticosterone levels as GFAP-bGH mice are lean and have
unchanged food intake compared with wild-type mice (3,
13) (60a). It can therefore be argued that peripheral GH
overexpression counteracts the effect of central GH overexpression on food intake and obesity. Moreover, it is
possible that peripheral GH overexpression counteracts
the effect of high corticosterone levels on food intake and
obesity. To investigate whether GH has a direct effect in
the CNS on food intake without changing corticosterone
levels, we injected C57BL/6 mice with bGH ICV. Using this
model, we could show that GH increased food intake
without any effect on plasma corticosterone levels. This
finding argues against a major role of changed corticosterone levels for the observed effect of central GH overexpression on food intake. However, we cannot rule out the

FIG. 4. GFAP-bGH mice are hypercholesterolemic. Total cholesterol (A) and triglyceride
levels (B) in GFAP-bGH (Tg) and wild-type
(Wt) mice. Serum apoB levels were determined
with an electroimmunoassay (C), and hepatic
LDL receptor protein levels were identified
with Western blot (D). Serum lipoprotein size
distribution was determined in individual mice
using size exclusion high performance liquid
chromatography system, SMART (E). Littermate male GFAP-bGH and wild-type mice at the
age of 6 –7 months were used. Values are
means ⴞ SE (n ⴝ 7). *P < 0.05 and **P < 0.01
vs. wild type (Student’s t test).
DIABETES, VOL. 54, JANUARY 2005

59

GH OVEREXPRESSION IN THE CNS

TABLE 3
Fold change of genes involved in hepatic carbohydrate and lipid
metabolism and known GH-regulated genes
Gene
GH signalling and responsive genes
GH receptor (GHR)
IGF-I
Genes dependent of GH secretion pattern
Prolactin receptor (PRLR)
Testosterone 16-␣-hydroxylase (C-16-␣)
3-Ketosteroid reductase (HSD3b5)
Carbonic anhydrase (CAIII)
Major urinary protein I (MUP I)
Major urinary protein III (MUP III)
Major urinary protein IV (MUP IV)
Major urinary protein V (MUP V)
Fatty acid activation
Long chain fatty acyl-CoA synthetase (LACS)
Very-long-chain acyl-CoA synthetase (VLACS)
␤-Oxidation and ketone formation
Medium-chain acyl-CoA dehydrogenase
(MCAD)
HMG CoA synthase, mitochondrial (HMGCS)
Peroxisomal acyl-CoA oxidase (AOX)
Sterol-carrier protein X (SCP-X)
Basic metabolic rate
Type 1 deiodinase (DIOI) (⫽5⬘-deiodinase)
Lipases
Hepatic triglyceride lipase (HL)
Scavenger receptors
Scavenger receptor class B type I (SR-BI)
Lipoprotein metabolism
ApoA-I precursor
ApoA-IV
ApoA-V
ApoB editing complex 1
ApoC-II
Cholesterol acyltransferase (LCAT)
Cholesterol biosynthesis
Squalene epoxidase (Sqle)
Cholesterol-7-␣-hydroxylase
Niemann-Pick C1 protein (Npc1)
Carbohydrate metabolism
Phosphoenolpyruvate carboxykinase 1
(PEPCK)
Glycerol kinase (Gyk)
Fatty acid synthesis
ATP-citrate-lyase

Fold
change

ACKNOWLEDGMENTS

⫺1.84

This study was supported by the European Commission
(MitAge QLRT 2000-00054), the Swedish Medical Research
Council (grants 4250, 4499, 6834, and 14291), the Swedish
Cancer Foundation, the Swedish Foundation for Strategic
Research, the Lundberg Foundation, the Swedish Medical
Society, AstraZeneca Research and Development, Pharmacia-Upjohn, Novo Nordisk Foundation, Albert Påhlsson
Foundation, Swedish Diabetes Association, King Gustav
V’s and Queen Victoria’s Foundation, Sahlgrenska University Foundation, the Swedish Heart and Lung Foundation,
and the Swedish Association Against Rheumatic Disease.
We thank Maud Pettersson, Lena Kvist, Doris Persson,
Anna Karin Gerdin, Lena Amrot Fors, and Anne-Cristine
Carlsson for excellent technical assistance and Jean
Tessier and Rod Pickford for help with the magnetic
resonance imaging/magnetic resonance spectra analysis.
We also thank Kerstin Enquist, Mona Bystro¨m, and Eva
Jonsson for help with the real-time PCR analysis, Dr.
Stefan Pierrou for careful revision of this manuscript, and
SWEGENE Centre for Bio-Imaging (CBI), Go¨teborg University for technical support regarding Image analysis
(pQCT).

⫺1.35

REFERENCES

2.13
NC
7.8
11.4
⫺49
⫺2.4
⫺2.4
⫺2.9
⫺4.3
⫺3.5
⫺1.6
⫺1.5
⫺1.3
⫺1.5
⫺1.9
⫺1.8
2.23

⫺1.35
4.15
⫺1.27
1.61
2.11
1.27
1.6
1.6
⫺1.5
⫺2.6
⫺1.6
1.7

Positive value denote upregulation, and negative scores indicate
downregulation in livers of transgenic animals (n ⫽ 6) when compared with livers of wild-type littermate controls (n ⫽ 6). Littermates
at the age of 6 –7 months were used. NC, no change.

possibility that the changed corticosterone levels have a
modulatory role on the peripheral effects observed in the
GFAP-bGH mice. Because glucocorticoids and GH have
similar effects on lipolysis (24) and insulin sensitivity
(43,44), it is likely that the high corticosterone levels in
both Mt-bGH and GFAP-bGH mice contribute to the insulin resistance observed in both animal models.
In conclusion, GH overexpression in the CNS results in
obesity associated with hyperphagia. The increased food
intake might be explained by a marked increase in AGRP
and a slight increase in NPY mRNA levels in the hypothalamus. These data indicate that the effect of GH in the CNS
60

can increase food intake and produce leptin resistance
without peripheral GH deficiency. Thus, if increased GH
production in the CNS is not balanced by an increased
peripheral metabolic effect of GH, obesity will develop.

1. Bengtsson BA, Eden S, Lonn L, Kvist H, Stokland A, Lindstedt G, Bosaeus
I, Tolli J, Sjostrom L, Isaksson OG: Treatment of adults with growth
hormone (GH) deficiency with recombinant human GH. J Clin Endocrinol
Metab 76:309 –317, 1993
2. Bengtsson BA, Brummer RJ, Eden S, Bosaeus I, Lindstedt G: Body
composition in acromegaly: the effect of treatment. Clin Endocrinol (Oxf)
31:481– 490, 1989
3. Frick F, Bohlooly-YM, Linden D, Olsson B, Tornell J, Eden S, Oscarsson J:
Long-term growth hormone excess induces marked alterations in lipoprotein metabolism in mice. Am J Physiol Endocrinol Metab 28:E1230 –E1239,
2001
4. Tominaga A, Arita K, Kurisu K, Uozumi T, Migita K, Eguchi K, K IIda,
Kawamoto H, Mizoue T: Effects of successful adenomectomy on body
composition in acromegaly. Endocr J 45:335–342, 1998
5. Azain MJ, Roberts TJ, Martin RJ, Kasser TR: Comparison of daily versus
continuous administration of somatotropin on growth rate, feed intake,
and body composition in intact female rats. J Anim Sci 73:1019 –1029, 1995
6. Bunger L, Hill WG: Role of growth hormone in the genetic change of mice
divergently selected for body weight and fatness. Genet Res 74:351–360,
1999
7. Eisen EJ, Peterson CB, Parker IJ, Murray JD: Effects of zinc ion concentration on growth, fat content and reproduction in oMT1a-oGH transgenic
mice. Growth Dev Aging 62:173–186, 1998
8. Bengtsson BA, Brummer RJ, Eden S, Bosaeus I: Body composition in
acromegaly. Clin Endocrinol (Oxf) 30:121–130, 1989
9. De Boer H, Blok GJ, Voerman HJ, De Vries PM, van der Veen EA: Body
composition in adult growth hormone-deficient men, assessed by anthropometry and bioimpedance analysis. J Clin Endocrinol Metab 75:833– 837,
1992
10. Hahn TM, Copeland KC, Woo SL: Phenotypic correction of dwarfism by
constitutive expression of growth hormone. Endocrinology 137:4988 –
4993, 1996
11. Blissett J, Harris G, Kirk J: Effect of growth hormone therapy on feeding
problems and food intake in children with growth disorders. Acta Paediatr
89:644 – 649, 2000
12. Snel YE, Brummer RJ, Doerga ME, Zelissen PM, Koppeschaar HP: Energy
and macronutrient intake in growth hormone-deficient adults: the effect of
growth hormone replacement. Eur J Clin Nutr 49:492–500, 1995
13. Berryman DE, List EO, Coschigano KT, Behar K, Kim JK, Kopchick JJ:
DIABETES, VOL. 54, JANUARY 2005

M. BOHLOOLY AND ASSOCIATES

Comparing adiposity profiles in three mouse models with altered GH
signaling. Growth Horm IGF Res 14:309 –318, 2004
14. Clark RG, Jansson JO, Isaksson O, Robinson IC: Intravenous growth
hormone: growth responses to patterned infusions in hypophysectomized
rats. J Endocrinol 104:53– 61, 1985
15. Roberts TJ, Azain MJ, Hausman GJ, Martin RJ: Interaction of insulin and
somatotropin on body weight gain, feed intake, and body composition in
rats. Am J Physiol 267:E293–E299, 1994
16. Schulz C, Wieczorek I, Reschke K, Lehnert H: Effects of intracerebroventricularly and intraperitoneally administered growth hormone on body
weight and food intake in fa/fa Zucker rats. Neuropsychobiology 45:36 – 40,
2002
17. Gossard F, Dihl F, Pelletier G, Dubois PM, Morel G: In situ hybridization to
rat brain and pituitary gland of growth hormone cDNA. Neurosci Lett
79:251–256, 1987
18. Hojvat S, Baker G, Kirsteins L, Lawrence AM: Growth hormone (GH)
immunoreactivity in the rodent and primate CNS: distribution, characterization and presence posthypophysectomy. Brain Res 239:543–557, 1982
19. Lobie PE, Garcia-Aragon J, Lincoln DT, Barnard R, Wilcox JN, Waters MJ:
Localization and ontogeny of growth hormone receptor gene expression in
the central nervous system. Brain Res Dev Brain Res 74:225–233, 1993
20. Mustafa A, Nyberg F, Bogdanovic N, Islam A, Roos P, Adem A: Somatogenic and lactogenic binding sites in rat brain and liver: quantitative
autoradiographic localization. Neurosci Res 20:257–263, 1994
21. Lai ZN, Emtner M, Roos P, Nyberg F: Characterization of putative growth
hormone receptors in human choroid plexus. Brain Res 546:222–226, 1991
22. Lai Z, Roos P, Zhai O, Olsson Y, Fholenhag K, Larsson C, Nyberg F:
Age-related reduction of human growth hormone-binding sites in the
human brain. Brain Res 621:260 –266, 1993
23. Sjo¨gren K, Wallenius K, Liu JL, Bohlooly-Y M, Pacini G, Svensson L, To¨rnell
J, Isaksson OGP, Ahren B, Jansson JO, Ohlsson C: Liver-derived IGF-I is of
importance for normal carbohydrate and lipid metabolism. Diabetes
50:1539 –1545, 2001
24. Goodman HM, Schwartz Y, Tai LR, Gorin E: Actions of growth hormone on
adipose tissue: possible involvement of autocrine or paracrine factors.
Acta Paediatr Scand Suppl 367:132–136, 1990
25. Linden D, Sjoberg A, Asp L, Carlsson L, Oscarsson J: Direct effects of
growth hormone on production and secretion of apolipoprotein B from rat
hepatocytes. Am J Physiol Endocrinol Metab 279:E1335–E1346, 2000
26. Campfield LA, Smith FJ, Guisez Y, Devos R, Burn P: Recombinant mouse
OB protein: evidence for a peripheral signal linking adiposity and central
neural networks. Science 269:546 –549, 1995
27. Shafrir E: Development and consequences of insulin resistance: lessons
from animals with hyperinsulinaemia. Diabetes Metab 22:122–131, 1996
28. Seeley RJ, Yagaloff KA, Fisher SL, Burn P, Thiele TE, van Dijk G, Baskin
DG, Schwartz MW: Melanocortin receptors in leptin effects. Nature
390:349, 1997
29. Cheung CC, Clifton DK, Steiner RA: Proopiomelanocortin neurons are
direct targets for leptin in the hypothalamus. Endocrinology 138:4489 –
4492, 1997
30. Mountjoy KG, Wong J: Obesity, diabetes and functions for proopiomelanocortin-derived peptides. Mol Cell Endocrinol 128:171–177, 1997
31. Fan W, Boston BA, Kesterson RA, Hruby VJ, Cone RD: Role of melanocortinergic neurons in feeding and the agouti obesity syndrome. Nature
385:165–168, 1997
32. Shutter JR, Graham M, Kinsey AC, Scully S, Luthy R, Stark KL: Hypothalamic expression of ART, a novel gene related to agouti, is up-regulated in
obese and diabetic mutant mice. Genes Dev 11:593– 602, 1997
33. Ollmann MM, Wilson BD, Yang YK, Kerns JA, Chen Y, Gantz I, Barsh GS:
Antagonism of central melanocortin receptors in vitro and in vivo by
agouti-related protein. Science 278:135–138, 1997
34. Halaas JL, Boozer C, Blair-West J, Fidahusein N, Denton DA, Friedman JM:
Physiological response to long-term peripheral and central leptin infusion
in lean and obese mice. Proc Natl Acad Sci U S A 94:8878 – 8883, 1997
35. Lu D, Willard D, Patel IR, Kadwell S, Overton L, Kost T, Luther M, Chen W,
Woychik RP, Wilkison WO, Cone RD: Agouti protein is an antagonist of the
melanocyte-stimulating-hormone receptor. Nature 371:799 – 802, 1994
36. Kalra SP, Dube MG, Pu S, Xu B, Horvath TL, Kalra PS: Interacting
appetite-regulating pathways in the hypothalamic regulation of body
weight. Endocr Rev 20:68 –100, 1999
37. Erickson JC, Hollopeter G, Palmiter RD: Attenuation of the obesity
syndrome of ob/ob mice by the loss of neuropeptide Y. Science 274:1704 –
1707, 1996
38. Sahu A: Evidence suggesting that galanin (GAL), melanin-concentrating
hormone (MCH), neurotensin (NT), proopiomelanocortin (POMC) and
DIABETES, VOL. 54, JANUARY 2005

neuropeptide Y (NPY) are targets of leptin signaling in the hypothalamus.
Endocrinology 139:795–798, 1998
39. Chan YY, Steiner RA, Clifton DK: Regulation of hypothalamic neuropeptide-Y neurons by growth hormone in the rat. Endocrinology 137:1319 –
1325, 1996
40. Bohlooly-YM, Olsson B, Gritli-Linde A, Brusehed O, Isaksson OG, Ohlsson
C, Soderpalm B, Tornell J: Enhanced spontaneous locomotor activity in
bovine GH transgenic mice involves peripheral mechanisms. Endocrinology 142:4560 – 4567, 2001
41. Morberg PH, Isaksson OG, Johansson CB, Sandstedt J, Tornell J: Improved
long-term bone-implant integration: experiments in transgenic mice overexpressing bovine growth hormone. Acta Orthop Scand 68:344 –348, 1997
42. Oscarsson J, Ottosson M, Eden S: Effects of growth hormone on lipoprotein lipase and hepatic lipase. J Endocrinol Invest 22 (Suppl. 5):2–9, 1999
43. Foss MC, Saad MJ, Paccola GM, Paula FJ, Piccinato CE, Moreira AC:
Peripheral glucose metabolism in acromegaly. J Clin Endocrinol Metab
72:1048 –1053, 1991
44. Kopchick JJ, Bellush LL, Coschigano KT: Transgenic models of growth
hormone action. Annu Rev Nutr 19:437– 461, 1999
45. Wallenius V, Wallenius K, Ahren B, Rudling M, Carlsten H, Dickson SL,
Ohlsson C, Jansson JO: Interleukin-6-deficient mice develop mature-onset
obesity. Nat Med 8:75–79, 2002
46. Windahl SH, Vidal O, Andersson G, Gustafsson JA, Ohlsson C: Increased
cortical bone mineral content but unchanged trabecular bone mineral
density in female ERbeta(-/-) mice. J Clin Invest 104:895–901, 1999
47. Sjoberg A, Oscarsson J, Olofsson SO, Eden S: Insulin-like growth factor-I
and growth hormone have different effects on serum lipoproteins and
secretion of lipoproteins from cultured rat hepatocytes. Endocrinology
135:1415–1421, 1994
48. Linden D, Alsterholm M, Wennbo H, Oscarsson J: PPARalpha deficiency
increases secretion and serum levels of apolipoprotein B-containing
lipoproteins. J Lipid Res 42:1831–1840, 2001
49. Myrsen U, Ahren B, Sundler F: Dexamethasone-induced neuropeptide Y
expression in rat islet endocrine cells: rapid reversibility and partial
prevention by insulin. Diabetes 45:1306 –1316, 1996
50. Bruss ML, Black AL: Enzymatic microdetermination of glycogen. Anal
Biochem 84:309 –312, 1978
51. Maffei M, Halaas J, Ravussin E, Pratley RE, Lee GH, Zhang Y, Fei H, Kim
S, Lallone R, Ranganathan S, Kern PA, Friedman JM: Leptin levels in
human and rodent: measurement of plasma leptin and ob RNA in obese
and weight-reduced subjects. Nat Med 1:1155–1161, 1995
52. Ahren B, Mansson S, Gingerich RL, Havel PJ: Regulation of plasma leptin
in mice: influence of age, high-fat diet, and fasting. Am J Physiol 273:R113–
R120, 1997
53. Chen HL, Romsos DR: A single intracerebroventricular injection of dexamethasone elevates food intake and plasma insulin and depresses metabolic rates in adrenalectomized obese (ob/ob) mice. J Nutr 125:540 –545,
1995
54. van Driel IR, Davis CG, Goldstein JL, Brown MS: Self-association of the
low density lipoprotein receptor mediated by the cytoplasmic domain.
J Biol Chem 262:16127–16134, 1987
55. Johnson D, al-Shawi R, Bishop JO: Sexual dimorphism and growth
hormone induction of murine pheromone-binding proteins. J Mol Endocrinol 14:21–34, 1995
56. Morgan ET, MacGeoch C, Gustafsson JA: Hormonal and developmental
regulation of expression of the hepatic microsomal steroid 16 alphahydroxylase cytochrome P-450 apoprotein in the rat. J Biol Chem 260:
11895–11898, 1985
57. Keeney DS, Murry BA, Bartke A, Wagner TE, Mason JI: Growth hormone
transgenes regulate the expression of sex-specific isoforms of 3 betahydroxysteroid dehydrogenase/delta 5–⬎4-isomerase in mouse liver and
gonads. Endocrinology 133:1131–1138, 1993
58. Jeffery S, Carter ND, Clark RG, Robinson IC: The episodic secretory
pattern of growth hormone regulates liver carbonic anhydrase III. Studies
in normal and mutant growth-hormone-deficient dwarf rats. Biochem J
266:69 –74, 1990
59. Wren AM, Small CJ, Ward HL, Murphy KG, Dakin CL, Taheri S, Kennedy
AR, Roberts GH, Morgan DG, Ghatei MA, Bloom SR: The novel hypothalamic peptide ghrelin stimulates food intake and growth hormone secretion. Endocrinology 141:4325– 4328, 2000
60. Nakazato M, Murakami N, Date Y, Kojima M, Matsuo H, Kangawa K,
Matsukura S: A role for ghrelin in the central regulation of feeding. Nature
409:194 –198, 2001
60a. Olsson B, Bohlooly YM, Fitzgerald SM, Frick F, Ljungberg A, Ahren B,
Tornell J, Bergstrom G, Oscarsson J: Bovine growth hormone transgenic
mice are resistant to diet-induced obesity but develop hyperphagia,
61

GH OVEREXPRESSION IN THE CNS

dyslipidemia and diabetes on a high fat diet. Endocrinology 2004 [Epub
ahead of print]
61. Hollingshead PG, Martin L, Pitts SL, Stewart TA: A dominant phenocopy of
hypopituitarism in transgenic mice resulting from central nervous system
synthesis of human growth hormone. Endocrinology 125:1556 –1564, 1989
62. Szabo M, Butz MR, Banerjee SA, Chikaraishi DM, Frohman LA: Autofeedback
suppression of growth hormone (GH) secretion in transgenic mice expressing
a human GH reporter targeted by tyrosine hydroxylase 5⬘-flanking sequences
to the hypothalamus. Endocrinology 136:4044–4048, 1995
63. Ikeda A, Chang KT, Matsumoto Y, Furuhata Y, Nishihara M, Sasaki F,
Takahashi M: Obesity and insulin resistance in human growth hormone
transgenic rats. Endocrinology 139:3057–3063, 1998
64. Cai A, Hyde JF: The human growth hormone-releasing hormone transgenic
mouse as a model of modest obesity: differential changes in leptin receptor
(OBR) gene expression in the anterior pituitary and hypothalamus after
fasting and OBR localization in somatotrophs. Endocrinology 140:3609 –
3614, 1999
65. Johannsson G, Albertsson-Wikland K, Bengtsson BA: Discontinuation of
growth hormone (GH) treatment: metabolic effects in GH-deficient and
GH-sufficient adolescent patients compared with control subjects. Swedish
Study Group for Growth Hormone Treatment in Children. J Clin Endocrinol Metab 84:4516 – 4524, 1999
66. Olsson B, Bohlooly-Y M, Brusehed O, Isaksson OG, Ahren B, Olofsson SO,
Oscarsson J, Tornell J: Bovine growth hormone-transgenic mice have
major alterations in hepatic expression of metabolic genes. Am J Physiol
Endocrinol Metab 285:E504 –E511, 2003
67. Norstedt G, Palmiter R: Secretory rhythm of growth hormone regulates
sexual differentiation of mouse liver. Cell 36:805– 812, 1984
68. Belfiore F, Iannello S: Insulin resistance in obesity: metabolic mechanisms
and measurement methods. Mol Genet Metab 65:121–128, 1998

62

69. Hotamisligil GS: Molecular mechanisms of insulin resistance and the role
of the adipocyte. Int J Obes Relat Metab Disord. 24 (Suppl. 4):S23–S27,
2000
70. Wong HY, Ahren B, Lips CJ, Hoppener JW, Sundler F. Postnatally disturbed
pancreatic islet cell distribution in human islet amyloid polypeptide
transgenic mice. Regul Pept. 15:113:89 –94, 2003
71. Devedjian JC, George M, Casellas A, Pujol A, Visa J, Pelegrin M, Gros L,
Bosch F: Transgenic mice overexpressing insulin-like growth factor-II in
beta cells develop type 2 diabetes. J Clin Invest 105:731–740, 2000
72. Trigatti B, Rayburn H, Vinals M, Braun A, Miettinen H, Penman M, Hertz M,
Schrenzel M, Amigo L, Rigotti A, Krieger M: Influence of the high density
lipoprotein receptor SR-BI on reproductive and cardiovascular pathophysiology. Proc Natl Acad Sci U S A 96:9322–9327, 1999
73. Teng B, Blumenthal S, Forte T, Navaratnam N, Scott J, Gotto AM Jr, Chan
L: Adenovirus-mediated gene transfer of rat apolipoprotein B mRNAediting protein in mice virtually eliminates apolipoprotein B-100 and
normal low density lipoprotein production. J Biol Chem 269:29395–29404,
1994
74. Tataranni PA, Larson DE, Snitker S, Young JB, Flatt JP, Ravussin E: Effects
of glucocorticoids on energy metabolism and food intake in humans. Am J
Physiol 271:E317–E325, 1996
75. Wajchenberg BL: Subcutaneous and visceral adipose tissue: their relation
to the metabolic syndrome. Endocr Rev 2:697–738, 2000
76. Masuzaki H, Paterson J, Shinyama H, Morton NM, Mullins JJ, Seckl JR,
Flier JS: A transgenic model of visceral obesity and the metabolic
syndrome. Science 294:2166 –2170, 2001
77. Makimura H, Mizuno TM, Isoda F, Beasley J, Silverstein JH, Mobbs CV:
Role of glucocorticoids in mediating effects of fasting and diabetes on
hypothalamic gene expression. BMC Physiol 3:5, 2003

DIABETES, VOL. 54, JANUARY 2005




Télécharger le fichier (PDF)

Bohlooly-05-Endocrinol.pdf (PDF, 436 Ko)

Télécharger
Formats alternatifs: ZIP







Documents similaires


bohlooly 05 endocrinol
jn83nt2
am j epidemiol 1996 ferrini 642 4
ncomms3685
57lcje7
platelet production and destruction in liver cirrhosis