Fichier PDF

Partagez, hébergez et archivez facilement vos documents au format PDF

Partager un fichier Mes fichiers Boite à outils PDF Recherche Aide Contact



ED Biochimie 2016 .pdf



Nom original: ED Biochimie 2016.pdf
Auteur: Marc DENIS

Ce document au format PDF 1.6 a été généré par Word / Mac OS X 10.10.5 Quartz PDFContext, et a été envoyé sur fichier-pdf.fr le 22/09/2016 à 17:42, depuis l'adresse IP 92.90.x.x. La présente page de téléchargement du fichier a été vue 458 fois.
Taille du document: 4.4 Mo (34 pages).
Confidentialité: fichier public




Télécharger le fichier (PDF)









Aperçu du document


Première Année Commune aux Etudes de Santé
UFR de Médecine - Nantes

BIOCHIMIE & BIOLOGIE MOLECULAIRE
Enseignements Dirigés

Rappel de consignes :
1. Respectez le groupe qui vous a été attribué
2. Apprenez le cours et faites les exercices avant
chaque séance

Année universitaire 2016-2017

 
Glucides  
 
1.  D’une  manière  générale,  les  aldohexoses  cycliques,  non  engagés  dans  une  liaison  osidique  :  
A. ont  une  conformation  plus  stable  que  la  forme  linéaire  
B. sont  secondaires  à  une  réaction  d’hémi-­‐acétalisation  intra-­‐moléculaire  
C. possèdent  cinq  carbones  asymétriques,  soit  32  isomères  
D. sont  en  anomérie  β  quand  le  OH  en  C1  est  en  trans  par  rapport  au  CH2OH  
 
2.  D’une  manière  générale  les  aldohexoses  cycliques,  engagés  dans  une  liaison  osidique  par  leur  C1  :  
A. ont  une  anomérie  fixée  
B. subissent  le  phénomène  de  mutarotation  
C. peuvent  être  réduits  en  alditol  
D. récupèrent  leur  OH  hémiacétalique  en  C1  après  hydrolyse  (chimique  ou  enzymatique)    
 
 
La   maladie   de   Fabry,   ou   syndrome   de   Ruiter-­‐Pompen-­‐Wyers,   est   une   maladie   lysosomale  
génétique,   liée   au   chromosome   X,   résultant   d'un   déficit   enzymatique   qui   conduit   à   l’accumulation   du  
composé  Y,  dont  la  structure  figure  ci-­‐dessus,  dans  les  tissus  et  le  plasma.  
 

Y

 
Le  composé  Y  est  traité  de  façon  à  isoler  la  partie  oligosaccharidique.    
 
3.  Précisez  si  les  propositions  suivantes  concernant  la  partie  oligosaccharidique  isolée  sont  vraies  ou  
fausses.  
A. Elle  possède  un  caractère  réducteur  
B. Elle  peut  subir  le  phénomène  de  mutarotation  
C. A  et  C  sont  deux  molécules  identiques  
D. A  et  C  sont  deux  anomères  
E. B  et  C  sont  deux  épimères  
 
4.  La  molécule  A  est  isolée  à  partir  du    composé  Y.  Précisez  si  
les  propositions  suivantes  sont  vraies  ou  fausses.  
CHO
CHO
CH2OH
A. A  et  D  sont  des  épimères  
HO
H
H
OH
O
B. Par  réduction,  A  (isolée)  et  D  donnent  des  produits  
HO
H
HO
H
HO
H
identiques  
C. Par  réduction,  E  et  F  donnent  des  produits  
H
OH
HO
H
H
OH
identiques  
H
OH
H
OH
H
OH
D. Par  réduction,  A  (isolée)  et  F  donnent  des  produits  
CH2OH
CH2OH
CH2OH
identiques  
E. Par  réduction,  C  (isolée)  et  E  donnent  les  mêmes  
D
E
F
 
produits  
 
 

 

1  

La   maladie   de   Pompe   appartient   à   un   groupe   d’affections   héréditaires   rares,   les   glycogénoses  
encore   appelées   maladies   de   stockage   du   glycogène.   Cette   maladie   est   secondaire   à   un   déficit   en  
glycosidases  et  peut  donc  toucher  tous  les  organes  humains.  Elle  se  caractérise  par  le  dépôt  de  glycogène  
en  quantité  ou  en  qualité  anormales  dans  les  tissus.  
 
5.  Indiquez  si  les  propositions  suivantes  concernant  le  glycogène  sont  vraies  ou  fausses.  
A. C’est  un  oligosaccharide  complexe  
B. C’est  un  homopolysaccharide  de  réserve  
C. C’est  un  hétéropolysaccharide  
D. Il  s’apparente  à  l’amylopectine  
E. Il  adopte  une  disposition  spiralée    
 
6.   Parmi   les   diholosides   suivants,   indiquez   celui   qui   constitue   majoritairement,   par   sa   répétition,   le  
glycogène  :  
 
 

 
 
7.   Parmi   les   diholosides   suivants,   indiquer   celui   qui   constitue   majoritairement,   par   sa   répétition,   le  
glycogène  :    
A. D  galactopyranosyl  β  (1  →  4)  D  glucopyranose  
B. D  glucopyranosyl  α  (1  →  6)  D  glucopyranose  
C. D  galactopyranosyl  α  (1  →  4)  D  glucofuranose  
D. D  glucopyranosyl  β  (1  →  4)  D  glucopyranose  
E. D  glucopyranosyl  α  (1  →  4)  D  glucopyranose  
 
8.   Indiquez   si,   après   méthylation   du   glycogène   suivie   d’une   hydrolyse   acide,   les   dérivés   suivants   sont  
obtenus  :    
A. 2,3,4,6  tétraméthylglucose  
B. 2,3,4,6  tétraméthylgalactose  
C. 2,3,4  triméthylglucose  
D. 2,3,6  triméthylglucose  
E. 2,3  diméthylglucose  
 
9.  Indiquez  si  les  propositions  suivantes  concernant  la  molécule  ci-­‐dessous  sont  vraies  ou  fausses.    
 
 
A. Cette  molécule  est  réductrice  
B. Du  1,3,4,6  tétra-­‐méthyl-­‐fructose  est  obtenu  après  méthylation  exhaustive  et  hydrolyse  
C. Du  3,4,5  tri-­‐méthyl-­‐fructose  est  obtenu  après  méthylation  exhaustive  et  hydrolyse  
 
 

 

2  

 
La   galactosémie   congénitale   est   associée   à   une   altération   de   la   glycosylation   de   certaines  
glycoprotéines.   Ainsi,   la   FSH   (Hormone   Folliculo   Stimulante),   glycoprotéine   d’origine   hypophysaire,  
présente   des   structures   glycanniques   dépourvues   de   galactose   chez   les   patients.   La   figure   ci-­‐dessous  
présente  une  étape  de  la  biosynthèse  de  la  principale  chaîne  glycannique  normale  de  la  FSH.  L’acronyme  
AA  indique  un  acide  aminé  de  la  chaîne  peptidique.    
 

 
 
10.  Indiquez  si  les  propositions  suivantes  sont  vraies  ou  fausses.  
A. L’acide  aminé  AA  est  une  sérine  
B. L’acide  aminé  AA  est  une  thréonine  
C. Le  dérivé  d’ose  lié  à  la  chaîne  peptidique  est  un  anomère  α  
D. Le  dérivé  d’ose  lié  à  la  chaîne  peptidique  est  un  anomère  β  
E. La  chaîne  glycannique  Y  fait  partie  des  glycosaminoglycanes  
 
11.  Indiquez  si  les  propositions  suivantes  sont  vraies  ou  fausses.  
A. La  chaîne  glycannique  Y  peut  être  hydrolysée  par  une  α-­‐galactosidase  
B. La  chaîne  glycannique  Y  peut  être  hydrolysée  par  une  α-­‐mannosidase  
C. La  chaîne  glycannique  Y  peut  être  hydrolysée  par  une  β-­‐galactosidase  
D. La  chaîne  glycannique  Y  peut  être  isolée  par  l’action  d’une  exoglycosidase  
E. La  chaîne  glycannique  Y  isolée  présente  deux  extrémités  réductrices  
 
 
 

 

 

3  

 
Lipides  
 
 
1. Qu’est-­‐ce  qu’une  molécule  amphipathique  (amphiphile)  ?  
•  Pourquoi  le  pH  a-­‐t-­‐il  une  influence  sur  l’hydrophilie  des  acides  gras  ?  
•  Cette  influence  est-­‐elle  la  même  si  l’acide  gras  estérifié  du  glycérol  ?  
 
2. En  considérant  les  composés  présentés  page  suivante  répondez  par  vrai  ou  faux  aux  questions  suivantes  :  
 
Composé  :   A   B   C   D   E   F   G  
C’est  un  lipide  simple  
 
 
 
 
 
   
C’est  un  lipide  complexe  
 
 
 
 
 
   
C’est  un  phospholipide  
 
 
 
 
 
   
C’est  un  glycérophospholipide  
 
 
 
 
 
   
C’est  un  sphingolipide  
 
 
 
 
 
   
C’est  un  céride  
 
 
 
 
 
   
Il  est  hydrophobe  
 
 
 
 
 
   
Il  peut  être  précurseur  de  molécules  agissant  comme  messagers  
 
 
 
 
 
   
C’est  un  constituant  des  lipides  membranaires  
 
 
 
 
 
   
C’est  un  médiateur  de  la  réponse  inflammatoire  
 
 
 
 
 
   
Peut  subir  l’action  de  la  phospholipase  A2  
 
 
 
 
 
   
Composé  provenant  du  cholestérol  
 
 
 
 
 
   
Il  exerce  un  rôle  énergétique  
 
 
 
 
 
   
 




H  
 
 
 
 
 
 
 
 
 
 
 
 
 

I  
 
 
 
 
 
 
 
 
 
 
 
 
 

Identifiez  les  classes  de  lipides  auxquelles  appartiennent  les  molécules.  
Indiquez  les  liaisons  chimiques  entre  les  éléments  constitutifs  des  molécules.  

 
3. Soient  les  acides  gras  suivants  :  
 
C16  :  0,  C18  :  0,  C18  :  1  (ω9),  C18  :  2(ω6),  C20  :  4(ω6)  
 
et  les  points  de  fusion  :  
-­‐43,5°C,  5°C,  -­‐5°C,  13°C,  63°C,  70°C  
 
• Donner  le  nom  des  différents  acides  gras.  
• Apparier  acides  gras  et  points  de  fusion.  
• Quels  aspects  structuraux  de  ces  acides  gras  peuvent  être  en  rapport  avec  les  variations  des  points  
de  fusion  ?  

 

4.   En   suspension   dans   l’eau   les   acides   gras   forment   des   micelles   et   les   phospholipides   forment   des  
liposomes.  Pourquoi  ?  Quel  est  l’intérêt  pharmaceutique  des  liposomes  ?      
La  micelle  suivante  se  forme-­‐t-­‐elle  dans  l’huile  ou  dans  l’eau  ?  
 

 

 

 

 

4  

 

A  

 

 

B

 C  

 

 D  

E  
 

 

F  

 G  

 
 

 I  

 H  

 

 
 

 

 

5  

5.  A  partir  du  tableau  ci-­‐dessous  expliquer  la  stratégie  adoptée  par  une  bactérie  pour  maintenir  sa  fluidité  
membranaire  vitale,  si  elle  est  transférée  d’un  milieu  à  40°C  dans  un  milieu  à  30°C,  puis  à  10°C  ?  
 
Pourcentage  des  acides  gras  totaux  de  E.coli,  cultivé  à  différentes  températures  
 
10°C  
20°C  
30°C  
40°C  
Myristique  (14  :0)  
4  
4  
4  
8  
Palmitique  (16  :0)  
18  
25  
29  
48  
Palmitoléique  (16  :  1)  
26  
24  
23  
9  
Oléique  (18  :1)  
38  
34  
30  
12  
Hydroxymyristique  
13  
10  
10  
8  
Rapport  insaturés/saturés  
2,9  
2,0  
1,6  
0,38  
 
 
6.  Le  sérum  renferme  différentes  formes  de  phosphore  précisées  dans  le  tableau  ci-­‐dessous.  
 
Formes  de  phosphore  
Quantité  moyenne  du  phosphore  en  g.dm-­‐3  de  
sérum  
P  minéral  
0,036  
P  lipidique  
0,075  
P  des  phosphodérivés  de  glucides  
0,008  
P  total  
0,125  
 
• Préciser  la  signification  de  «  phosphore  lipidique  ».    
 
• Par   traitement   du   sérum   avec   un   mélange   chloroforme-­‐méthanol,   on   obtient   l’extrait   lipidique  
total   (contenant   du   Cholestérol,   des   Triacylglycérols   et   des   Phospholipides).   Une   séparation   des  
constituants   de   cet   extrait   par   chromatographie   sur   couche   mince   de   gel   de   silice   donne   les  
résultats  regroupés  sur  la  figure  ci-­‐dessous  (deux  chromatographies  ont  été  réalisées),  identifier  les  
dépôts  en  justifiant  votre  réponse.    
 
• Que  pouvez-­‐vous  conclure  de  ces  deux  chromatographies  ?  
 

 
 

 

Phase  (1)    
 
Ether  de  pétrole  90  volumes  
Ether  éthylique  10  volumes  
Ethanoïques  1  volume  

Phase  (2)  
Chloroforme  65  volumes  
Méthanol  25  volumes  
Eau  1  volume  

 

 

6  

 
Considérez  la  molécule  suivante  :  
CO
O
O
CO

O
O

P

O

OH

+ CH3
N
CH3
H3C

7.  Indiquez  si  la  molécule  représentée  ci-­‐dessus  présente  les  caractéristiques  suivantes.  
A. Elle  est  amphiphile  
B. C’est  un  constituant  des  membranes  biologiques  
C. C’est  une  molécule  de  réserve  énergétique  
D. C’est  un  glycérophospholipide  
E. C’est  un  sphingolipide  
 
8.  Indiquez  si  cette  molécule  contient  les  constituants  suivants.  
A. Un  acide  gras  de  la  famille  des  ω  6  
B. Un  acide  gras  de  la  famille  des  ω  3  
C. Un  glucose  
D. Une  sphingosine  
E. Un  glycérol  

 

9.  Indiquez  si  les  enzymes  suivantes  sont  capables  d’hydrolyser  cette  molécule.  
A. Le  lysosyme  
B. L’amylase  pancréatique  
C. La  phospholipase  A2  
D. La  phospholipase  D  
E. La  ribonucléase  T1  

 
Cette  molécule  est  soumise  à  une  hydrolyse  simultanée  par  les  enzymes  ci-­‐dessus.    
 
10.  Indiquez  si  parmi  le(s)  produit(s)  obtenu(s),  on  obtient  :  
A. Un  acide  gras  saturé  
B. Un  acide  gras  insaturé  
C. Un  glucose  
D. Un  céramide  
E. De  la  sphingosine  
 
 
 
Considérez  les  molécules  suivantes  :  

 

 
 

 

7  

11.  Précisez  si  les  propositions  suivantes  concernant  le  rôle  des  composés  A,  B  et  C,  s’ils  sont  présents  dans  
les  lipides  membranaires,  sont  vraies  ou  fausses.  
A. Ils   participent   à   la   structure   des   membranes   biologiques   en   rentrant   dans   la   composition   des  
glycérophospholipides  
B. Dans  les  glycérophospholipides,  la  liaison  glycérol-­‐acide  gras  est  une  liaison  éther  
C. Soumis  à  une  oxydation  ménagée,  ils  se  transforment  en  composés  de  type  peroxyde  
D. Comme  les  acides  gras  saturés,  le  composé  C  participe  à  la  rigidité  des  membranes  biologiques  du  
fait  de  sa  structure  linéaire  
E. Les  composés  A  et  B  participent  à  la  fluidité  membranaire  grâce  aux  inflexions  dans  leur  structure,  
imposées  par  la  configuration  
 
12.  Précisez  si  les  propositions  suivantes  concernant  les  liposomes,  sont  vraies  ou  fausses.  
A. Ils  sont  constitués  d’une  bicouche  lipidique  séparant  un  milieu  intérieur  et  un  milieu  extérieur  
aqueux  
B. Ils  sont  obtenus  par  resuspension  de  lipides  en  milieu  aqueux  
C. Ils  ont  une  organisation  similaire  aux  micelles  de  détergent  
D. Ils  sont  utilisés  pour  encapsuler  des  médicaments  
E. Ils  ont  la  même  composition  lipidique  que  les  membranes  
 
13.  Précisez  si  les  propositions  suivantes  concernant  l’acide  arachidonique,  sont  vraies  ou  fausses.  
A. C’est  un  acide  gras  polyinsaturé  de  la  famille  des  ω6  
B. Il  possède  20  atomes  de  carbone  
C. C'est  un  acide  gras  dit  "tétraènoïque"  car  il  possède  4  insaturations  
D. L’acide  arachidonique  est  un  précurseur  des  thromboxanes  
E. Il  possède  une  température  de  fusion  supérieure  à  l’acide  octadécanoïque  
 
 
 

La  molécule  X  fait  partie  d’un  groupe  de  molécules  largement  répandues  chez  l’homme  dans  le  
tissu  cérébral  et  les  tissus  nerveux.  Sa  formule  est  présentée  ci-­‐dessous.  

 
 
14.  Parmi  les  propositions  suivantes  concernant  le  constituant  A,  quelle(s)  est(sont)  celle(s)  qui  est(sont)  
exacte(s)  ?  
A. Le  constituant  A  est  un  épimère  au  niveau  C2  du  D-­‐glucose  
B. Le  constituant  A  est  une  molécule  de  D-­‐mannose  
C. Le  constituant  A  est  une  molécule  de  D-­‐galactose  
D. Le  constituant  A  est  un  épimère  au  niveau  C4  du  D-­‐glucose  
E. Le  constituant  A  est  un  cétose  
 
 

 

 

8  

 
15.  Parmi  les  propositions  suivantes  concernant  la  nature  du  constituant  B,  quelle(s)  est(sont)  celle(s)  qui  
est(sont)  exacte(s)  ?  
A. Le  constituant  B  est  un  céramide  
B. Le  constituant  B  est  un  monoacylglycéride  
C. Le  constituant  B  est  un  glycosphingolipide  
D. Le  constituant  B  est  un  sphingophospholipide  
E. Le  constituant  B  est  un  stéride  
 
16.  Parmi  les  propositions  suivantes  concernant  la  molécule  X,  quelle(s)  est(sont)  celle(s)  qui  est(sont)  
exacte(s)  ?  
A. La  molécule  X  est  amphiphile  
B. La  molécule  X  est  totalement  hydrophobe  
C. La  molécule  X  s’insère  dans  la  membrane  plasmique  grâce  au  constituant  B  
D. La  molécule  X  possède  une  double  liaison  de  configuration  trans  
E. La  molécule  X  possède  une  liaison  amide  
 
17.  La  masse  moléculaire  de  X  est  égale  à  789g  x  mol-­‐1.  On  donne  I=127.  Quel  est  l’indice  d’iode  de  la  
molécule  X  ?  
A. L’indice  d’iode  est  égal  à  16  
B. L’indice  d’iode  est  égal  à  636  
C. L’indice  d’iode  est  égal  à  64  
D. L’indice  d’iode  est  égal  à  318  
E. L’indice  d’iode  est  égal  à  32  
 
 

 

 

9  

 
Acides  aminés  –  Peptides  -­‐  Protéines  
 
 
1.  Indiquez  si  les  propositions  suivantes  concernant  les  acides  aminés  naturels  sont  vraies  ou  fausses.  
A. Ils   se   caractérisent   toujours   par   la   présence   d’une   fonction  carboxylique   et   d’une   fonction   amine  
primaire  
B. Ils  sont  toujours  ionisables  à  l’état  libre  
C. Ils  peuvent  posséder  soit  deux,  soit  trois  constantes  d’acidité  
D. Ils  peuvent  être  estérifiés  sur  leur  fonction  NH2  
E. Les  acides  aminés  indispensables  sont  au  nombre  de  12  
F. Ce  sont  des  acides  carboxyliques  
G. Ils  possèdent  toujours  un  carbone  asymétrique  
H. Ils  sont  protonés  en  milieu  acide  
 
2.  Indiquez  si  les  propositions  suivantes  concernant  la  cystéine  sont  vraies  ou  fausses.  
A. Elle  possède  une  fonction  amine  primaire    
B. C'est  un  acide  aminé  hydroxylé  
C. Elle  peut  se  condenser  avec  une  cystine  pour  former  une  cystéine    
D. Elle  est  impliquée  dans  la  formation  de  pont  disulfure  
E. Elle  participe  à  la  structure  quaternaire  des  protéines  
 
3.  Parmi  les  structures  suivantes,  reconnaître  celle  de  l’asparagine  (Asn)  :    
a)

c)

b)
COOH

O
NH2







NH2

OH

NH

d) NH

O

COOH

O

H2N

COOH

N

NH

COOH

2
NH2
NH2
 
 
 
Quelle  est  la  nature  du  groupement  fonctionnel  de  la  chaîne  latérale  ?  
Peut-­‐on  envisager  l'hydrolyse  de  Asn  ?  Si  oui,  écrire  la  réaction  et  nommer  les  produits  
Quelles  sont  les  formes  moléculaires  de  Asn  et  Asp  dans  le  milieu  intracellulaire  à  pH  7,2  ?  On  
utilisera  les  valeurs  approximatives  suivantes  :    
pK1  (αCOOH)  =  2  ;  pK2  (αNH2)  =  9  ;  pKR  (COOH)  =  4.    
Donner  le  nom  et  la  nature  du  composé  issu  de  la  décarboxylation  de  la  fonction  αCOOH  de  Asp,  
quel  est  le  rôle  biologique  de  ce  composé  ?  

 
4.  Précisez  si  les  propositions  concernant  la  liaison  peptidique  sont  vraies  ou  fausses.  
A. Elle  est  rigide  et  plane.  
B. Elle  protège  les  protéines  vis-­‐à-­‐vis  des  protéases.  
C. Elle  est  à  la  base  de  la  structure  primaire.  
D. L’atome  hydrogène  de  l’azote  et  l’oxygène  du  carbonyle  sont  en  configuration  cis.  
E. La  rotation  est  possible  entre  le  Cα  et  le  C  du  groupement  carbonyle.  
F. Le  carbonyle,  le  radical  R  et  l’azote  sont  dans  un  seul  plan.    
G. Les  angles  Φ  et  Ψ  sont  les  angles  de  rotation  autour  des  liaisons  Cα-­‐R  et  Cα-­‐H,  respectivement  
 
5.  Le  glutathion  :  
A. est  un  polypeptide  
B. possède  une  fonction  SH  
C. peut  exister  sous  une  forme  oxydée  ou  sous  une  forme  réduite  
D. est  obtenu  par  cyclisation  de  l’acide  glutamique  
E. possède  un  noyau  aromatique  
F. est  chargé  positivement  à  pH  neutre  (Glu  :  pK COOH  =  2,12  ;  pKaNH2  =  8,66  ;  Cys  :  pKSH  =  9,62  ;  Gly  :  
pKaCOOH  =  3,53)  
 
α

 

 

10  

 

6.  Le  peptide  suivant  est  utilisé  pour  étudier  l’activité  phosphotransférase  d’une  enzyme  :  
 
H2N
C
H2C
CH3
H2N

CH2OH

O
NH

NH

NH

O

O
H3C

O H2C

NH

CH2
NH

NH
CH2

NH

O HC
2

CH3

COOH
CH2
S
CH3

 
 







 
Identifier  les  acides  aminés  et  écrire  sa  séquence  
Quelle  est  la  charge  électrique  globale  de  ce  peptide  à  pH  neutre  ?    
Quel(s)  acide(s)  aminé(s)  sera(seront)  susceptible(s)  d’être  phosphorylé(s)  ?    
Quelle  sera  la  charge  électrique  globale  du  peptide  à  l’issue  de  la  réaction  ?    
Comment  peut-­‐on  envisager  la  séparation  du  peptide  d’origine  et  de  sa  forme  modifiée  ?  

La  tyrosine  est  un  acide  aminé  largement  répandu  dans  les  peptides  et  les  protéines.  
 
7.  Précisez  si  les  formules  suivantes  représentant  la  tyrosine  sont  vraies  ou  fausses  :  
 
OH

A
C
H2N H COOH

H2N H COOH
C

B

CH2

NH2

C
OH

H2N H COOH
C

D
CH2

C
H2N H COOH

CH2

HO

E

N
H
CH2

C
H2N H COOH

OH
 
 
A
E
B
C
D
8.  Précisez  si  les  composés  biologiques  suivants  proviennent  de  la  tyrosine.  
A. La  sérotonine  
B. La  noradrénaline  
C. L’histamine  
D. La  thyroxine  
E. La  dopamine  
 
9.   Précisez   si   les   propositions   suivantes   concernant   la   tyrosine   et   les   propriétés   chimiques   de   sa   chaîne  
latérale  dans  les  protéines  à  pH  7,2  sont  vraies  ou  fausses.  
A. La  tyrosine  est  un  acide  aminé  indispensable  
B. La  tyrosine  peut  faire  l’objet  d’une  glycosylation  
C. La  fonction  phénol  peut  intervenir  dans  des  interactions  ioniques  
D. La  fonction  phénol  peut  intervenir  dans  des  interactions  hydrogène  
E. La  fonction  phénol  peut  réagir  avec  les  chaînes  latérales  ayant  un  COOH  pour  former  des  amides  
reliant  deux  parties  d’une  chaîne  peptidique  
 
La  tyrosine  sert  également  de  base  à  la  synthèse  des  hormones  thyroïdiennes.  La  sécrétion  de  T3  et  de  T4  
est   sous   contrôle   hormonal.   L’hypophyse   produit   la   TSH   (thyrotropine)   qui   stimule   la   formation   et   la  
sécrétion  de  T3  et  de  T4  par  la  thyroïde.  La  sécrétion  de  la  TSH  est  elle-­‐même  dépendante  de  la  stimulation  
provenant  de  la  TRH  (hormone  thyréotrope).  Ces  deux  hormones,  TSH  et  TRH  sont  de  nature  peptidique.  

 

 

11  

 
La   TRH   est   produite   par   l'hypothalamus.   Sa   structure   est   présentée   ci-­‐dessous   et   correspond   à   la  
séquence  :    oxo  Pro  -­‐  His  -­‐  Pro  amide  
 
N

HN
O
NH

N

N
H

O

O

O

NH2

 
 
10.  Précisez  si  les  propositions  suivantes  concernant  la  TRH  sont  vraies  ou  fausses.  
A. Ce  peptide  comporte  3  carbones  asymétriques  
B. Ce  peptide  comporte  4  liaisons  hydrolysables  
C. Ce  peptide  n’est  pas  hydrolysé  par  les  exopeptidases  
D. Ce  peptide  ne  comporte  pas  d’élément  ionisable  
E. Ce  peptide  est  susceptible  d’être  glycosylé  
 
11.  Précisez  si  les  propositions  concernant  la  mobilité  électrophorétique  de  la  TRH  sont  vraies  ou  fausses.  
On  donne  :  pKA  du  NH  imidazole  =  6,0  
A. La  migration  de  la  TRH  ne  dépend  que  de  l’ionisation  du  noyau  imidazole  
B. A  pH  10  :  la  TRH  migre  vers  l’anode  
C. A  pH  9  :  la  TRH  migre  vers  la  cathode  
D. A  pH  3  :  la  TRH  migre  vers  la  cathode  
E. A  pH  2  :  la  TRH  migre  vers  l’anode  
 
La   TSH   est   distribuée   par   voie   sanguine.   La   chaîne   α   de   la   TSH   renferme   116   acides   aminés.   Sa  
composition,  déduite  du  gène,  exprimée  en  nombre  de  résidus  est  la  suivante  :  
 
Alanine    
7   Cystéine    
10   Histidine    
5   Méthionine  
4   Thréonine    
9  
Arginine    
4   Ac.  glutamique     4   Isoleucine  
2   Phénylalanine     6   Tyrosine    
7  
Asparagine    
4   Glutamine    
5   Leucine    
8   Proline  
7   Valine    
10  
Ac.  aspartique   3   Glycine  
4   Lysine    
7   Sérine  
10  
 
 
 
12.  Précisez  si  les  propositions  suivantes  sont  vraies  ou  fausses  :  
A. La  chaîne  α  de  la  TSH  comporte  16  sites  potentiels  de  coupure  par  la  trypsine  
B. Théoriquement,  la  coupure  par  la  chymotrypsine  génère  au  maximum  13  fragments  peptidiques  
C. Tous  les  acides  aminés  indispensables  sont  nécessaires  lors  de  la  biosynthèse  de  la  chaîne  a  de  la  
TSH  
D. La  chaîne  α  de  la  TSH  comporte  123  carbones  asymétriques  
E. La  chaîne  α  de  la  TSH  est  une  protéine  plutôt  acide  
 
13.   Précisez   si   les   propositions   suivantes   concernant   les   modifications   post-­‐traductionnelles   de   cette  
protéine,  sont  vraies  ou  fausses  :  
A. La   chaîne   α   de   la   TSH   peut   être   glycosylée  :   N-­‐glycosylation   avec   l’asparagine   et   la   glutamine,   et   O-­‐
glycosylation  avec  la  sérine  et  la  thréonine  
B. La  chaîne  α  de  la  TSH  peut  être  phosphorylée  
C. Glycosylation  et  phosphorylation  sont  irréversibles  in  vivo  
D. Grâce   aux   acides   aminés   soufrés,   cystéine   et   méthionine,   elle   peut   comporter   jusqu’à   7   ponts  
disulfure  
E. Elle  fait  l’objet  d’une  myristylation  
 
 

 

12  

14.  Indiquez  si  les  propositions  suivantes  concernant  les  protéines  sont  vraies  ou  fausses.  
A. Elles  possèdent  toujours  une  structure  quaternaire.  
B. Elles  débutent  toujours  par  une  méthionine  lors  de  leur  synthèse.  
C. Elles  peuvent  lier  par  covalence  des  entités  non  protéiques.  
D. Elles  conservent  leur  structure  primaire  quand  elles  sont  dénaturées.  
E. Les  protéines  naturelles  contiennent  le  plus  souvent  des  hélices  droites  
 
15.  Le  schéma  suivant  représente  un  fragment  de  protéine  avec  les  chaînes  latérales  de  certains  des  acides  
aminés.    
NH
O

NH

O
d)

O
NH
NH

HN

HO
a)

c)

O

O

b)

-O

-

O

+
NH 3

O

O

O-

NH

NH

NH
O

O

NH
HN

HN




O

SH HS

Identifier  les  acides  aminés  
Associer  à  chacune  des  lettres  la  liaison  ou  l'interaction  susceptible  de  s’établir.  

 

 
16.  Indiquez  si  les  propositions  suivantes  concernant  les  modifications  post-­‐traductionnelles  sont  vraies  ou  
fausses  
A. Une  protéine  peut  être  modifiée  après  traduction  sur  plusieurs  acides  aminés.  
B. Un  acide  aminé  peut  être  la  cible  de  plusieurs  modifications  post-­‐traductionnelles.  
C. Les  modifications  post-­‐traductionnelles  des  protéines  sont  toujours  réversibles.  
D. La  phosphorylation  des  protéines  conduit  toujours  à  leur  activation.  
E. L’addition  d’un  groupement  glucidique  s’effectue  toujours  à  l’extrémité  N  terminale  de  la  protéine.  
 
17.  Indiquez  si  les  propositions  suivantes  concernant  les  immunoglobulines  sont  vraies  ou  fausses.  
A. Les  immunoglobulines  possèdent  une  structure  quaternaire  en  hélice  alpha  uniquement.  
B. L’analyse   d’immunoglobulines   purifiées   par   électrophorèse   en   gel   dénaturant   (SDS-­‐PAGE)   puis  
coloration  fait  apparaître  deux  bandes  de  poids  moléculaire  identique.  
C. Les  immunoglobulines  plasmatiques  sont  séparables  des  autres  protéines  sériques  en  fonction  de  
leur  charge  par  électrophorèse.  
D. Les  immunoglobulines  G  sont  des  tétramères.  
E. Elles  sont  stabilisées  par  la  présence  de  ponts  disulfure  inter  et  intra  chaînes.  
 
18.  Soit  la  séquence  peptidique  suivante,  qui  appartient  à  une  glycoprotéine  :  
NH2
O

COOH

SH

C
CH2

O
NH

O

CH2 OH

O

NH

NH
O

H3C

CH2

O
NH

NH

CH2

CH2

O
H3C

O
NH

NH

CH2
N

NH

O

O

CH3

HN

CH3

(CH2)4

O
H3C

O

NH

NH2

 
 

 

13  






Identifier  les  acides  aminés.    
Quelles  sont  les  liaisons  peptidiques  dont  l'hydrolyse  est  catalysée  par  la  trypsine  ?  par  la  
chymotrypsine  ?    
Quel(s)  acide(s)  aminé(s)  peut  (peuvent)  être  engagé(s)  dans  la  liaison  à  l’enchaînement  
glucidique  ?  
Quel(s)  acide(s)  aminé(s)  est  (sont)  susceptible(s)  d’être  impliqué(s)  dans  des  interactions  
hydrogène  ?  

 
19.  Indiquez  si  les  propositions  suivantes  concernant  le  dodécyl  sulfate  de  sodium  (SDS)  sont  vraies  ou  
fausses.  
A. C’est  un  détergent  
B. C’est  un  agent  réducteur  
C. Il  s’associe  aux  acides  aminés  apolaires  hydrophobes  
D. Il  peut  dissocier  deux  monomères  liés  par  des  liaisons  faibles  
E. Il  peut  être  utilisé,  lors  d’une  électrophorèse,  pour  mettre  en  évidence  les  sous  unités  d’une  
protéine  liées  par  des  ponts  disulfures  
 
Concours  2012-­‐2013  :  
 
 
La   production   de   testostérone   par   les   testicules   est   contrôlée   par   l’hormone   lutéinisante   (LH)  
produite  par  l’hypophyse  en  réponse  à  l’hormone  de  libération  de  l’hormone  lutéinisante  (LHRH)  produite  au  
niveau  de  l’hypothalamus.  La  structure  de  la  forme  active  de  la  LHRH  est  présentée  ci-­‐dessous.  

O

 
20.  Indiquez  si  les  propositions  suivantes  concernant  la  LHRH  sont  vraies  ou  fausses.  
A. La  LHRH  comporte  11  acides  aminés  
B. La  LHRH  est  un  décapeptide  
C. Son  extrémité  N-­‐terminale  est  modifiée  
D. A  pH  neutre,  la  LHRH  possède  une  charge  électrique  globale  positive  
E. Quel  que  soit  le  pH,  la  LHRH  est  toujours  électriquement  neutre  
 
21.  Indiquez  si  les  propositions  suivantes  concernant  la  LHRH  sont  vraies  ou  fausses.  
A. Une  aminopeptidase  hydrolyse  la  LHRH  
B. Le  bromure  de  cyanogène  est  sans  effet  sur  la  LHRH  
C. La  trypsine  clive  la  LHRH  en  2  peptides  
D. La  carboxypeptidase  libère  l’acide  aminé  C-­‐terminal  :  la  glycine  
E. La  chymotrypsine  est  sans  effet  sur  la  LHRH  

 

 

 

 

14  

 
La  LHRH  circule  dans  le  sang  et  en  se  fixant  sur  son  récepteur  situé  à  la  surface  des  cellules  cibles  
(anté-­‐hypophyse….),  induit  la  synthèse  de  LH.  
 
La   LH   fait   partie,   comme   l’hormone   thyréo-­‐stimulante   (TSH)   et   l’hormone   folliculo-­‐stimulante   (FSH),  
de   la   famille   des   gonadotropines.   Elle   est   formée   de   2   sous-­‐unités   glycoprotéiques   (α   et   β)   associées   de  
manière  non  covalente.  
 

22.  Indiquez  si  les  acides  aminés  suivants  sont  susceptibles,  par  leur  chaîne  latérale,  d’être  impliqués  dans  
l’association  entre  les  2  chaînes   (hors  interactions  de  Van  der  Waals).  
A. Sérine  
B. Acide  glutamique  
C. Proline  
D. Glycine  
E. Tyrosine  
 

 
LH   et   FSH   ont   été   purifiées   et   analysées,   avant   (-­‐   NGlyc)   ou   après   (+NGlyc)   traitement   par   une   N-­‐
glycosidase   (enzyme   capable   d’hydrolyser   les   liaisons   N-­‐osidiques).   Les   peptides   obtenus   ont   été   analysés  
par   électrophorèse   dénaturante   (SDS-­‐PAGE),   et   révélés   par   coloration   des   protéines   (A)   ou   par  
immunoempreinte,  après  transfert  sur  une  membrane,  à  l’aide  d’un  anticorps  dirigé  contre  la  chaîne  α    de  la  
LH  (B).  Les  résultats  suivants  ont  été  obtenus  :  

A

-­‐ NGlyc

+  NGlyc

-­‐ NGlyc

+  NGlyc

LH

LH

LH

LH

FSH

FSH

FSH

FSH

B

20  kDa -­‐
15  kDa -­‐
12  kDa -­‐
10  kDa -­‐

 

 

23.  Indiquez  si  les  propositions  suivantes  concernant  l’électrophorèse  SDS-­‐PAGE  sont  vraies  ou  fausses.  
A. La  séparation  se  fait  en  fonction  de  la  charge  des  peptides  
B. L’analyse  a  obligatoirement  été  faite  en  présence  d’un  agent  réducteur  
C. En  présence  de  SDS,  les  protéines  se  déplacent  vers  la  cathode  
D. Le  gel  sert  de  tamis  moléculaire  qui  permet  la  séparation  
E. 1  kDa  correspond  à  la  masse  d’un  atome  d’hydrogène  
 

24.   Indiquez   si   les   propositions   suivantes   concernant   l’interprétation   de   ces   expériences   sont   vraies   ou  
fausses.  
A. La  LH  est  un  hétérodimère  
B. La  FSH  est  un  homodimère  
C. Les  2  chaînes  peptidiques  de  la  LH  sont  glycosylées  
D. La  LH  comporte  entre  200  et  300  acides  aminés  
E. La  FSH  comporte  environ  500  acides  aminés  
 

25.   Indiquez   si   les   propositions   suivantes   concernant   l’interprétation   de   ces   expériences   sont   vraies   ou  
fausses.  
A. Les  chaînes  α  de  la  LH  et  de  la  FSH  ont  une  structure  peptidique  commune  
B. Les  chaînes  β  de  la  LH  et  de  la  FSH  ont  une  structure  peptidique  commune  
C. Les  chaînes  α  de  la  LH  et  de  la  FSH  portent  des  structures  glycaniques  différentes  
D. Les  chaînes  β  de  la  LH  et  de  la  FSH  portent  des  structures  glycaniques  identiques  
E. L’anticorps  reconnaît  une  structure  glycanique  portée  par  les  peptides  
 
 
 

 

15  

Enzymes  
 
 
Le   métabolisme   de   Plasmodium   falciparum   met   en   jeu   la   fermentation   du   glucose   qui   produit   de  
l’énergie   sous   forme   d’ATP   grâce   à   la   transformation   du   glucose   en   acide   pyruvique.   Ce   dernier   est  
transformé  en  acide  lactique  par  la  lactate  déshydrogénase  du  parasite  (pf-­‐LDH).  
 
1.   L’électrophorèse   d’une   préparation   de   LDH   humaine   (h-­‐LDH)   purifiée   révèle   l’existence   de   plusieurs  
isoenzymes.  Indiquez  si  les  propositions  suivantes,  concernant  les  isoenzymes,  sont  vraies  ou  fausses.  
A. La  proportion  des  isoenzymes  peut  différer  d’un  tissu  à  l’autre  
B. Les  isoenzymes  catalysent  la  même  réaction  enzymatique  
C. Les  isoenzymes  ont  des  propriétés  immunologiques  identiques  
D. Les  isoenzymes  sont  caractérisées  par  des  affinités  identiques  pour  leur  substrat  
E. Les  isoenzymes  sont  des  protéines  oligomériques  
 
2.   La   LDH   catalyse   la   transformation   réversible   de   l’acide   pyruvique   (acide   2-­‐oxo-­‐propanoïque)   en   acide  
lactique   (acide   2-­‐hydroxy-­‐propanoïque)   en   présence   de   NAD+/NADH   +   H+.   Indiquez   si   les   propositions  
suivantes  sont  vraies  ou  fausses.  
A. La  LDH  catalyse  une  réaction  acide-­‐base  
B. La  LDH  catalyse  une  réaction  d’oxydo-­‐réduction  
C. La  vitesse  de  la  réaction  peut  être  déterminée  par  la  mesure  du  pH  du  milieu  réactionnel  
D. La  vitesse  de  la  réaction  peut  être  suivie  par  spectrophotométrie  à  340  nm  
E. Le  NADH  présente  un  pic  d’absorption  à  340  nm  
 

Les  acides  aminés  participant  aux  sites  actifs  ou  présents  dans  l’environnement  des  sites  actifs  de  la  LDH  
(lactate  déshydrogénase)  humaine  (h-­‐LDH)  et  de  la  LDH  de  P.  falciparum  (pf-­‐LDH)  sont  figurés  ci-­‐dessous  :  
 

N°  séq.    
h-­‐LDH    
pf-­‐LDH    

 
102                                                                                                                                                                                                                                                  109                140                163                168                171              195              245              246        250  
 Gln-­‐Gln-­‐Glu-­‐Gly-­‐Glu-­‐Ser-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐  Arg…Arg…Ser…Asp…Arg…His…Tyr…Thr…Ile    
 Lys-­‐Gln-­‐Glu-­‐Gly-­‐Glu-­‐Ser-­‐Asp-­‐Lys-­‐Glu-­‐Trp-­‐Asn-­‐  Arg…Arg…Leu…Asp…Arg…His…Ser…Pro..Pro    

 

Les   résidus   variables   du   site   actif   sont   figurés   en   gras   ;   les   résidus   conservés   du   site   actif   sont  
encadrés  et  l'ensemble  du  peptide  additionnel  inséré  avant  la  position  109  dans  la  pf-­‐LDH  parasitaire  est  en  
italique.  
 
3.  Indiquez  si  les  propositions  suivantes  sont  vraies  ou  fausses.  
A.  Le  site  actif  d’une  enzyme  est  constitué  par  une  courte  séquence  peptidique  
B.   Le   peptide   additionnel   de   5   acides   aminés   Asp-­‐Lys-­‐Glu-­‐Trp-­‐Asn   est   indispensable   à   l’activité  
catalytique  de  toutes  les  LDHs  
C.   Les   résidus   localisés   aux   positions   109,   140,   168,   171   et   195   participent   vraisemblablement   à  
l'activité  enzymatique  
D.  A  pH  7,2,  le  remplacement  de  la  glutamine  102  par  une  lysine  au  niveau  du  site  actif  de  la  pf-­‐LDH  
peut  modifier  la  conformation  du  site  actif  
E.  A  pH  7,2  la  lysine  102  peut  intervenir  dans  des  interactions  hydrogène  
 
4.  Les  constantes  de  Michaelis  (KM)  de  la  pf-­‐LDH  pour  les  acides  pyruvique  (2-­‐oxo-­‐propanoïque)  et  lactique  
(2-­‐hydroxy-­‐propanoïque)   ont   pour   valeurs   respectives   30   µM   et   12   000   µM.   Indiquez   si   les   propositions  
suivantes  sont  vraies  ou  fausses.  
A. Le  KM  correspond  à  la  constante  d’affinité  de  l’enzyme  pour  son  substrat  
B. Le  KM  correspond  à  la  constante  de  dissociation  apparente  du  complexe  enzyme-­‐substrat  
C. La  constante  de  Michaelis  correspond  à  la  concentration  de  substrat  pour  laquelle  la  vitesse  de  la  
réaction  est  égale  à  VM/2  
D. La  pf-­‐LDH  présente  une  plus  forte  affinité  pour  l'acide  lactique  que  pour  l’acide  pyruvique  
E. Dans  la  représentation  de  Lineweaver  et  Burk,  l’intersection  de  la  droite  avec  l’axe  des  abscisses  
détermine  la  valeur  –  1/KM  
 

 

16  

 
5.  La  constante  de  vitesse  de  formation  de  l'acide  lactique  est  égale  à  148  s-­‐1.  Sachant  que  la  concentration  
totale  en  pf-­‐LDH  est  égale  à  3,32  x  10-­‐4mM,  indiquez  si  les  propositions  suivantes  sont  vraies  ou  fausses.  
A. Le  katal  correspond  à  la  transformation  d'une  mole  de  substrat  par  minute  
B. Le  katal  est  une  unité  d’activité  enzymatique  
C. La   vitesse   maximale   VM   de   la   réaction   de   transformation   de   l'acide   pyruvique   en   acide   lactique   est  
égale  à  49,1  nM  x  s-­‐1  
D. La   vitesse   maximale   VM   de   la   réaction   de   transformation   de   l'acide   pyruvique   en   acide   lactique   est  
égale  à  21,5  nM  x  s-­‐1  
E. La   vitesse   maximale   VM   de   la   réaction   de   transformation   de   l'acide   lactique   en   acide   pyruvique   est  
égale  à  49,1  nM  x  s-­‐1  
 
6.   Le   Gossypol,   un   polyphénol,   se   comporte   comme   un   inhibiteur   compétitif   vis-­‐à-­‐vis   du   NADH.   La  
constante  de  Michaelis  KM  de  la  pf-­‐LDH  pour  le  NADH  est  égale  à  7  µM.  Le  Ki  de  la  pf-­‐LDH  pour  le  Gossypol  
est  de  0,7  µM.  Indiquez  si  les  propositions  suivantes  sont  vraies  ou  fausses.  
A. Le  Ki  représente  la  constante  de  dissociation  du  complexe  enzyme-­‐inhibiteur  
B. Le  gossypol  occupe  le  site  actif  de  la  pf-­‐LDH  
C. En   présence   de   Gossypol,   la   constante   de   Michaelis   (K’M)   de   la   pf-­‐LDH   pour   le   NADH   est   inférieure  
à  KM  
D. En  présence  de  Gossypol,  la  vitesse  maximale  apparente  V’M  de  la  pf-­‐LDH  pour  le  NADH  est  égale  à  
VM  
E. Les  données  sont  insuffisantes  pour  calculer  la  valeur  de  la  constante  de  Michaelis  apparente  K’M  
de  la  pf-­‐LDH  pour  le  NADH  
 
La   technique   de   mutagénèse   dirigée   par   des   oligonucléotides   permet   de   substituer   un   seul   acide  
aminé   d'une   protéine   conduisant   à   une   protéine   mutante.   Le   tableau   suivant   présente   les   valeurs   des  
paramètres  cinétiques  de  la  pf-­‐LDH  sauvage  et  de  la  pf-­‐LDH  mutée  au  niveau  du  résidu  245.  
 
 
pf-­‐LDH  sauvage  Ser245  
pf-­‐LDH  mutée  Ala245  
KM  NADH  (mM)  
7  
66  
KM  acide  pyruvique  (mM)  
30  
5  566  
k2  (seconde-­‐1)  
148  
0,42  
 
7.  Précisez  si  les  propositions  suivantes  sont  vraies  ou  fausses.  
A. Les  chaînes  latérales  de  l’alanine  et  de  la  sérine  diffèrent  par  la  présence  d’un  hydroxyle  
B. Un   acide   aminé   susceptible   de   former   une   interaction   hydrogène   se   montre   favorable   pour   le  
fonctionnement  catalytique  
C. L’encombrement   de   la   chaîne   latérale   de   l’alanine   gène   l’accessibilité   du   substrat   et   a   donc   un  
effet  défavorable  pour  le  fonctionnement  catalytique  
D. La  mutation  Ser→Ala  compromet  plus  la  liaison  de  l’acide  pyruvique  que  celle  du  NADH  
E. Des   inhibiteurs   spécifiques   se   fixant   sur   les   résidus   variables   de   la   pf-­‐LDH,   comme   la   sérine   245,  
ont  un  intérêt  thérapeutique  potentiel  
 
 
Concours  2012-­‐2013  :  
 
 
Les  hormones  androgènes  ont  de  nombreuses  actions  physiologiques.  Elles  stimulent  également  la  
prolifération  des  cellules  cancéreuses  prostatiques.  Aussi  plusieurs  approches  thérapeutiques  du  cancer  de  
la   prostate   visent   à   supprimer   la   production   d’androgènes.   L’abiratérone   (Zytiga™),   utilisée   pour   le  
traitement   de   cancers   de   la   prostate,   est   un   inhibiteur   compétitif   de   l’enzyme   CYP17A1   impliquée   dans   la  
production  d’androgènes.  
 
 

 

 

17  

 
8.  Indiquez  si  les  propositions  suivantes  concernant  les  enzymes  sont  vraies  ou  fausses.  
A. Les  enzymes  agissent  à  faible  concentration  et  sont  réutilisables  en  fin  de  réaction  
B. L’activité  des  enzymes  dépend  de  la  température  et  du  pH  
C. Toutes  les  enzymes  nécessitent  l’intervention  d’un  coenzyme  
D. Les  enzymes  augmentent  l’énergie  d’activation  de  la  réaction  qu’elles  catalysent  
E. Les  enzymes  modifient  l’équilibre  thermodynamique  de  la  réaction  qu’elles  catalysent  
 
9.  Indiquez  si  les  propositions  suivantes  concernant  le  site  actif  d’une  enzyme  sont  vraies  ou  fausses.  
A. Le  site  actif  est  uniquement  constitué  d’acides  aminés  soufrés  
B. Le  site  actif  occupe  une  part  réduite  du  volume  global  de  l’enzyme  
C. Le  site  actif  présente  une  complémentarité  structurale  avec  le  substrat  
D. Les   acides   aminés   composant   le   site   actif   sont   toujours   contigus   dans   la   séquence   primaire   de   la  
protéine  
E. Une  catalyse  efficace  se  caractérise  par  la  création,  au  niveau  du  site  actif,  de  liaisons  faibles  entre  
le  substrat  et  les  acides  aminés  de  contact  de  l’enzyme  
 
10.  Indiquez  si  les  propositions  suivantes  concernant  l’abiratérone  sont  vraies  ou  fausses.  
A. L’abiratérone  abaisse  la  VMax  de  CYP17A1  
B. L’abiratérone  modifie  le  KM  de  CYP17A1  
C. L’abiratérone  se  fixe  au  niveau  du  site  actif  de  l’enzyme  
D. L’abiratérone  se  fixe  de  manière  irréversible  à  CYP17A1  
E. L’abiratérone  entraîne  une  augmentation  de  la  concentration  plasmatique  en  testostérone  chez  les  
patients  traités  
 
 
En  fait,  la  forme  active  des  hormones  androgènes  chez  l’homme  provient  de  la  transformation  d’une  
partie  de  la  testostérone  par  une  5a  réductase.  Il  existe  2  enzymes  (E1  et  E2)  codées  par  des  gènes  différents  
catalysant   cette   réaction.   Ces   2   enzymes   utilisent   le   NADPH   comme   coenzyme.   Les   caractéristiques  
cinétiques  de  ces  2  enzymes  ont  été  déterminées  expérimentalement.  Les  résultats  obtenus  sont  présentés  
ci-­‐dessous.  
 

 
11.  Indiquez  si  les  propositions  suivantes  concernant  les  enzymes  E1  et  E2  sont  vraies  ou  fausses.  
A. Les  2  enzymes  doivent  avoir  la  même  masse  moléculaire  apparente  pour  être  des  isoenzymes.  
B. Les  enzymes  E1  et  E2  ont  la  même  vitesse  maximale.  
C. Les  enzymes  E1  et  E2  ont  la  même  affinité  pour  la  testostérone.  
D. L’enzyme  E1  a  une  meilleure  affinité  pour  la  testostérone  que  l’enzyme  E2.  
E. Les   données   obtenues   ne   permettent   pas   de   comparer   les   affinités   des   enzymes   E1   et   E2   pour   leur  
substrat.  

 
 

 

18  

Le  finastéride  est  un  inhibiteur  des  enzymes  E1  et  E2.  Le  comportement  de  l’enzyme  E1  vis-­‐à-­‐vis  du  
Finastéride  a  été  déterminé.  Les  résultats  ci-­‐dessous  ont  été  obtenus,  en  l’absence  (¨),  et  en  présence  de  
Finastéride  (0,1  nM  ;  n).  

 
12.  Indiquez  si  les  propositions  suivantes  sont  vraies  ou  fausses.  
A. VM  =  1  pmol  x  min-­‐1  x  mg-­‐1.  
B. KM  =  1,25  x  10-­‐9  M.  
C. Le  Ki  donne  une  indication  de  l’affinité  de  la  testostérone  pour  le  Finastéride.  
D. Ki  =  10  nM.  
E. Ki  =  0,1  nM.  

 
 

L'α-­‐(1→4)-­‐D-­‐glucosidase   est   une   enzyme   lysosomale   qui   permet   la   dégradation   du   glycogène   à  
partir  de  ses  extrémités  non  réductrices  et  l'hydrolyse  du  maltose  en  glucose.  
 
L'activité   enzymatique   de   l'α-­‐(1→4)-­‐D-­‐glucosidase   peut   être   évaluée   à   l'aide   de   deux   substrats  
synthétiques  :  le  paranitrophényl-­‐α-­‐D-­‐glucopyrannoside  (pNpG)  et  le  paranitrophényl-­‐α-­‐D-­‐xylopyrannoside  
(pNpX).  L'α-­‐(1→4)-­‐D-­‐glucosidase  catalyse  l'hydrolyse  du  pNpG  et  du  pNpX  conduisant  dans  les  deux  cas  au  
paranitrophénol  coloré.  
 
13.  Indiquez  si  les  propositions  suivantes  concernant  les  composés  A,  B,  C  et  D  sont  vraies  ou  fausses.  
NO2
CH2OH
O O
A

A.
B.
C.
D.
E.

O2N

CH2OH
O O

CH2OH
O
O
B

NO2

C

NO2

CH2OH
O O
D

 

Le  composé  A  correspond  au  métanitrophényl-­‐β-­‐D-­‐glucopyrannoside  
Le  composé  B  correspond  à  l’orthonitrophényl-­‐α-­‐D-­‐glucopyrannoside  
Le  composé  C  correspond  à  l’orthonitrophényl-­‐β-­‐D-­‐glucopyrannoside  
Le  composé  D  correspond  au  métanitrophényl-­‐β-­‐D-­‐glucopyrannoside  
Aucun  des  composés  ne  correspond  au  paranitrophényl-­‐α-­‐D-­‐glucopyrannoside  

 
Le   tableau   ci-­‐dessous   présente   les   caractéristiques   des   substrats   synthétiques   de   l'α-­‐(1→4)-­‐D-­‐
glucosidase.  
 
Substrat  
KM  (mM)  
k2  (s-­‐1)  
pNpG  
0,12  
90  
pNpX  
0,46  
0,05  
 

 

19  

14.  Précisez  si  les  propositions  suivantes  concernant  les  caractéristiques  des  substrats  synthétiques  de  l'α-­‐
(1→4)-­‐D-­‐glucosidase  sont  vraies  ou  fausses.  
A. L'efficacité  catalytique  de  l’enzyme  vis-­‐à-­‐vis  du  pNpG  est  supérieure  à  celle  du  pNpX  
B. Les  efficacités  catalytiques  de  l’enzyme  vis-­‐à-­‐vis  du  pNpG  et  du  pNpX  sont  similaires  
C. Les  différences  d'affinité  des  deux  substrats  sont  en  partie  dues  aux  orientations  des  groupements  
hydroxyles  situés  aux  positions  2,  3  et  4  du  cycle  pyrannique  
D. Les   différences   d'affinité   des   deux   substrats   sont   en   partie   dues   à   la   nature   du   substituant   situé   en  
position  position  5  du  cycle  pyrannique  
E. L'α-­‐(1→4)-­‐D-­‐glucosidase  a  une  faible  affinité  pour  les  substrats  paranitrophénylés  

 

 
Des   analogues   structuraux   du   glucose   ont   été   utilisés   pour   inhiber   l'activité   de   l'α-­‐(1→4)-­‐D-­‐
glucosidase  à  pH  6,2.  Les  valeurs  des  constantes  d'inhibition  sont  présentées  dans  le  tableau  ci-­‐dessous.  
 
Composé  
KI  (mM)  
1  
α-­‐D-­‐glucose  
2-­‐désoxy-­‐D-­‐glucose  
735  
Acide  D-­‐gluconique  
465  
Acide  D-­‐glucuronique  
406  
6-­‐désoxy-­‐D-­‐glucose  
0,4  
 
15.  Indiquez  si  les  propositions  suivantes  sont  vraies  ou  fausses.  
A. Les  dérivés  chargés  du  D-­‐glucose  possèdent  une  forte  affinité  pour  l'α-­‐(1→4)-­‐D-­‐glucosidase  
B. Une  interaction  hydrogène  avec  le  substituant  du  C6  n’est  pas  obligatoire  pour  la  liaison  du  substrat  
C. Une  interaction  hydrogène  avec  le  substituant  du  C2  est  importante  pour  la  liaison  du  substrat  
D. Une   fonction   acide   en   position   6   du   cycle   pyrannique   a   un   effet   défavorable   sur   la   liaison   du  
substrat  
E. Une  charge  négative  au  niveau  de  l’hydroxyle  anomérique  diminue  l’affinité  de  l’enzyme  
 
 
L’influence   du   pH   sur   cette   réaction   enzymatique   a   été   étudiée   au   moyen   de   deux   expériences.  
L’effet  du  pH  sur  l’activité  enzymatique  est  représenté  sur  la  figure  1.  Le  rôle  du  pH  sur  la  spécificité  de  l'α-­‐
(1→4)-­‐D-­‐glucosidase  est  illustré  par  les  résultats  de  l’expérience  2.    
 
D-Man
1/Ki
1/Ki
Figure  1  
Figure  2   D-Glc
3,6

Activité enzymatique
mM x s-1

2,7
1,8
0,9

°

°
5

°

°

°
°

400

° ° °°

°
°

300

°

200

°
7

°

D-Glc

*

°

6

mol x L-1

100

°
8

pH

°°

9

°

°

mol x L-1

°
°

*
* * °
*
*

*
D-Man

°

8,0
6,0
4,0

*

°

* *

°°

°

2,0
pH

5,5 6,0 6,5 7,0 7,5 8,0 8,5

 
16.  Précisez  si  les  propositions  suivantes  sont  vraies  ou  fausses.  
A. La  courbe  de  la  figure  1  permet  de  mettre  en  évidence  un  pH  optimum  voisin  de  6,2  
B. Lorsque  le  pH  est  inférieur  à  4  ou  supérieur  à  8,  le  substrat  est  dégradé  
C. Les   ordonnées   de   la   courbe   2   représentent   les   affinités   du   D-­‐glucose   et   du   D-­‐mannose   pour   l'α-­‐
(1→4)-­‐D-­‐glucosidase  
D. Les   ordonnées   de   la   courbe   2   représentent   les   constantes   d'inhibition   du   D-­‐glucose   et   du   D-­‐
mannose  
E. La  figure  2  permet  de  conclure  que  la  spécificité  de  l'α-­‐(1→4)-­‐D-­‐glucosidase  dépend  du  pH  
 

 

20  

 
17.  Précisez  si  les  propositions  suivantes  sont  vraies  ou  fausses.  
A. Les   deux   parties   de   la   courbe   de   la   figure   1   correspondent   aux   dissociations   de   fonctions   ionisables  
d'acides  aminés  localisés  au  niveau  du  site  actif  
B. Seul  un  substrat  chargé  peut  se  lier  au  site  actif  
C. La  charge  électrique  globale  du  site  actif  des  enzymes  est  nulle  au  pH  optimum  
D. Une  modification  de  pH  peut  induire  un  changement  de  conformation  du  site  actif  des  enzymes  
E. La  charge  électrique  des  substrats  ne  dépend  jamais  du  pH  
 
 

 

 

21  

Coenzymes  
 
 
1.  Indiquez  si  propositions  suivantes  sont  vraies  ou  fausses.  
A. Le  phosphate  de  pyridoxal  est  impliqué  dans  les  réactions  de  transamination  
B. Le  coenzyme  dérivant  de  la  vitamine  B6  participe  aux  réactions  de  décarboxylation  d’acides  aminés  
C. Le  groupement  méthyle  peut  être  transféré  par  l’acide  folique  
D. Le  méthotrexate  est  un  analogue  de  l’acide  folique  
E. La  biotine  dérive  de  la  vitamine  B8  
 
2.  Indiquez  si  les  propositions  concernant  le  NAD+  sont  vraies  ou  fausses.  
A. C’est  un  dinucléotide  
B. Il  est  sous  sa  forme  réduite  
C. Il  est  surtout  retrouvé  dans  les  mitochondries  
D. Il  participe  à  la  transformation  d’alcools  en  cétones  
E. Sa  forme  phosphorylée  est  dénommée  NADP+  
 
3.  Indiquez  si  les  propositions  concernant  le  coenzyme  A  sont  vraies  ou  fausses.  
A. C’est  un  coenzyme  d’acylation  
B. Il  renferme  de  nombreux  groupements  polaires  
C. Il  possède  une  fonction  thiol  réactionnelle  portée  par  une  cystéine  
D. Il  se  lie  au  radical  acyle  par  une  liaison  thioester  à  haut  potentiel  d’hydrolyse  
E. La  partie  active  est  un  groupement  acétyle  
 
4.  Indiquez  si  la  vitamine  B12  intervient  dans  les  réactions  suivantes.  
A. Isomérisation  
B. Migration  intramoléculaire  d’un  groupement  carboné  
C. Transfert  de  fonction  amine  
D. Carboxylation  
E. Transfert  de  radical  méthyle  
 
5.  Précisez  si  les  propositions  suivantes  concernant  les  coenzymes  sont  vraies  ou  fausses.  
A. Les  coenzymes  nicotiniques  présentent  un  hétérocycle  pyridine  substitué  
B. Le  NAD  participe  à  la  plupart  des  oxydo-­‐réductions  biologiques  
C. Le  NADP  participe  aux  réactions  de  transfert  de  phosphate  
D. Les  coenzymes  nicotiniques  ne  sont  impliqués  que  dans  des  réactions  d’oxydo-­‐réduction  
E. NAD,  NADP,  FAD  et  FMN  renferment  le  motif  adénine  –  ribose  –  (phosphate)2  
 
 
 
CH 3 – CO – SCoA
CH 3 – CHOH – COOH
L’acide  pyruvique  est  le  substrat  de  
Acétyl CoA
Acide lactique
plusieurs  réactions  métaboliques.  

‚
La  réaction  „  est  normalement  
Voie métabolique habituelle
CH 3 – CO – COOH
mineure.  En  cas  de  
Phénylalanine
Tyrosine
Acide pyruvique
Phénylalanine
phénylcétonurie,  maladie  
hydroxylase
génétique  liée  à  un  défaut  de  
ƒ
„
fonctionnement  de  la  
COOH – CH 2 – CO – COOH
Acide phénylpyruvique
Acide oxaloac étique
phénylalanine  hydroxylase,  cette  
CH 3 – CH – COOH
voie  est  largement  sollicitée  pour  
I
éliminer  l’excès  de  phénylalanine  
Acide
Acide
NH 2
phénylacétique phénylactique
Alanine
qui  est  toxique.  Il  en  résulte  chez  
les  malades,  des  concentrations  urinaires  élevées  des  métabolites  de  l’acide  phénylpyruvique,  
normalement  absent  chez  les  sujets  sains.  
 
 

 

22  

6.   La   réaction      est   une   réaction   qui   fait   intervenir   le   complexe   pyruvate   deshydrogénase   et   cinq  
coenzymes   dont   notamment   le   couple   FAD/FADH2   et   l’acide   lipoïque.   Indiquez   si   les   propositions   suivantes  
sont  vraies  ou  fausses.  
A. Le  TPP  est  l’un  des  coenzymes  impliqué  dans  la  réaction  
B. L’acétylCoA  correspond  à  l’acide  acétique  sous  forme  activée  
C. La  liaison  S-­‐CoA  est  une  liaison  thioéther  
D. Sous  forme  oxydée,  l’acide  lipoïque  comporte  un  pont  disulfure  intramoléculaire  
E. Le  FAD  dérive  de  la  vitamine  B2  (Riboflavine)  
 
7.   La   réaction   ‚   fait   intervenir   le   coenzyme   NAD.   Indiquez   si   les   propositions   suivantes   sont   vraies   ou  
fausses.  
A. Le  site  réactif  du  coenzyme  NAD  est  constitué  par  l’atome  d’azote  de  l’hétérocycle  
B. Le  NAD  dérive  de  la  vitamine  PP  
C. La  mesure  de  l’absorbance  à  340  nm  permet  de  suivre  la  réaction  enzymatique  in  vitro  
D. Le  NAD  est  un  coenzyme  pyridinique  
E. Une  autre  réaction  du  schéma  ci-­‐dessus  peut  avoir  pour  coenzyme  associé  le  NAD  
 
8.   La   réaction   ƒ   est   catalysée   par   la   pyruvate   carboxylase   et   fait   intervenir   2   coenzymes  :   la   biotine   et  
l’ATP.  Indiquez  si  les  propositions  suivantes  sont  vraies  ou  fausses.  
A. La  biotine  comporte  un  cycle  tétrahydrothiophène  
B. Le  site  réactif  de  la  biotine  est  constitué  par  l’atome  de  soufre  
C. Les  ions  bicarbonates  sont  une  source  de  CO2  pour  la  biotine  
D. La  biotine  est  fixée  de  façon  covalente  à  l’apoenzyme  
E. Le  rôle  de  l’ATP  dans  cette  réaction  est  de  fournir  de  l’énergie  
 
9.  Indiquez  si  les  propositions  suivantes  concernant  la  réaction  „  sont  vraies  ou  fausses.  
A. Le  coenzyme  associé  à  cette  réaction  dérive  de  la  vitamine  B6  
B. Le  coenzyme  associé  à  cette  réaction  est  lié  de  façon  covalente  à  l’apoenzyme  
C. Le  site  réactif  de  ce  coenzyme  est  représenté  par  l’hétéroatome  de  l’hétérocycle  
D. Le  coenzyme  associé  à  cette  réaction  intervient  également  dans  les  réactions  de  décarboxylation  
des  acides  aminés  
E. La  décarboxylation  de  l’alanine  conduit  à  l’éthanolamine  
 
 
10.   La   liaison   de   l'acide   rétinoïque   (AR)   aux   protéines   a   été   mesurée   à   l'aide   de   fractions   acellulaires  
enrichies  en  mitochondries.  Les  incubations  ont  été  réalisées  durant  90  minutes  à  37°C  en  présence  d'acide  
rétinoïque  100  nM  ;  0,5  mg  de  protéines  ;  MgCl2  :  27  mM  ;  en  présence  ou  absence  d'ATP  (10  mM)  et  CoASH  
(150  mM)  dans  un  tampon  Tris  100  mM  à  pH  7,4.  Les  incubations  sont  stoppées  par  l'acide  trichloroacétique  
qui   précipite   les   protéines.   Les   différentes   conditions   expérimentales   et   les   incorporations   d'acide   rétinoïque  
sont  présentées  sur  le  tableau.  
 
Composition  du  milieu  réactionnel  
Acide  rétinoïque  incorporé  
(pmoles/mg  protéines/90  minutes)  
+  ATP  +  CoASH  
22,48  
+  CoASH  
8,41  
+  ATP  
3,57  
+  ATP  ;  +  CoASH  ;  +  NEM  (5  mM)  
0,40  
+  ATP  ;  +  CoASH  ;  100°C  
0,52  
 
• Calculer  les  pourcentages  d'incorporation  d'acide  rétinoïque  par  rapport  à  une  référence  dont  on  
justifiera  le  choix.  
• Quel  est  le  nom  du  paramètre  qui  représente  l'incorporation  d'acide  rétinoïque  ?  

 

 

23  






Que  suggère  l'effet  de  l'élévation  de  la  température  à  100°C  ?  Définir  les  rôles  respectifs  de  l'ATP  et  
du  coenzyme  A.  
Le  N-­‐éthylmaléimide  (NEM)  est  un  réactif  des  fonctions  thiols.  Quelle  est  la  nature  de  l'acide  aminé  
impliqué  dans  la  fixation  de  l'acide  rétinoïque  ?  Quelle  est  la  nature  de  la  liaison  AR  -­‐  protéine  
substrat  ?  
Quels  sont  la  classe  et  le  nom  de  l'enzyme  participant  à  la  liaison  de  l'acide  rétinoïque  aux  protéines  
?  La  fixation  d'acide  rétinoïque  sur  une  protéine  substrat  a  été  nommée  rétinylation.  A  quel  type  de  
modification  peut-­‐on  la  comparer.  Quel  serait  son  rôle  potentiel  in  vivo  ?  

 
 
La   biotine   correspond   à   la   vitamine   H,   B8   ou   B7.   La   carence   en   biotine   est   rare   mais   expose   à   des  
troubles   divers.   Ces   troubles   ont   été   retrouvés   chez   des   personnes   qui   consomment   régulièrement   et   de  
façon   exagérée   des   œufs   crus.   Il   a   été   montré   que   le   blanc   d’œuf   contient   une   protéine,   l’avidine   qui  
présente   la   particularité   de   fixer   la   biotine.   De   ce   fait,   la   consommation   régulière   d’avidine   expose   à   un  
risque   de   carence   en   biotine,   lié   à   la   formation   du   complexe   avidine-­‐biotine   qui   empêche   l’absorption  
intestinale  de  la  biotine.  La  formule  de  la  biotine  est  rappelée  ci-­‐dessous  :  
 
O
NH

HN

S

(CH2)4

COOH

 
 
11.  Indiquez  si  propositions  suivantes  sont  vraies  ou  fausses.  
A. La  biotine  est  un  coenzyme  d’oxydo-­‐réduction  
B. La  biotine  est  un  coenzyme  de  transfert  
C. La  biotine  intervient  dans  les  réactions  de  carboxylation/décarboxylation  
D. La  biotine  intervient  dans  les  réactions  de  méthylation  
E. La  biotine  intervient  dans  la  régénération  des  coenzymes  à  fonction  thiol  comme  le  glutathion  
 
12.  Indiquez  si  propositions  suivantes  sont  vraies  ou  fausses.  
A. La  biotine  est  un  coenzyme  lié  de  façon  non  covalente  à  l’enzyme.  
B. La  biotine  est  liée  de  façon  covalente  à  l’enzyme.  
C. Le  site  réactif  est  constitué  par  l’atome  de  soufre.  
D. Le  site  réactif  est  constitué  par  la  fonction  acide  carboxylique.  
E. Le  site  réactif  est  constitué  par  l’un  des  atomes  d’azote.  
 
13.   La   biocytine   correspond   au   composé   qui   peut   se   former   entre   la   biotine   et   la   lysine,   que   cette   dernière  
soit  libre  ou  présente  dans  un  peptide.  Indiquez  si  les  propositions  suivantes  sont  vraies  ou  fausses.  
A. La  liaison  entre  biotine  et  lysine  est  une  liaison  imine  
B. La  liaison  entre  biotine  et  lysine  est  une  liaison  amide  
C. La  liaison  entre  biotine  et  lysine  est  une  liaison  anhydride  
D. La  liaison  entre  biotine  et  lysine  est  une  liaison  amine  
E. La  liaison  entre  biotine  et  lysine  est  une  liaison  éther  
 
Une   voie   métabolique   conduit   au   biotinyl-­‐coenzyme   A,   selon   un   schéma   réactionnel   identique   à  
celui   impliqué   dans   la   formation   d’un   acyl-­‐coenzyme   A.   Une   première   réaction   permet   d’obtenir   de   la  
biotine  activée.  La  réaction  d’activation  s’écrit  :  
 
Biotine          +          ATP  
 
 
Biotinyl-­‐AMP          +            PPi  
 
 

 

 

24  

14.  Indiquez  si  les  propositions  suivantes  sont  vraies  ou  fausses.  
A. La  liaison  entre  la  biotine  et  l’AMP  est  une  liaison  éther  
B. La  liaison  entre  la  biotine  et  l’AMP  est  une  liaison  ester  
C. La  liaison  entre  la  biotine  et  l’AMP  est  une  liaison  anhydride  
D. La  liaison  entre  la  biotine  et  l’AMP  est  non  covalente,  il  s’agit  d’un  complexe  
E. L’interaction  entre  la  biotine  et  l’AMP  est  ionique  
 
15.  Cette  réaction  implique  l’hydrolyse  de  l’ATP.  Indiquez  si  les  propositions  suivantes  sont  vraies  ou  
fausses.  
A. Le  couplage  avec  la  réaction  d’hydrolyse  de  l’ATP  rend  la  réaction  thermodynamiquement  possible  
B. La  réaction  évolue  spontanément  vers  la  droite  
C. La  réaction  n’évolue  vers  la  droite  qu’en  présence  de  l’enzyme  appropriée  
D. La  réaction  peut  être  considérée  comme  une  réaction  de  transfert  d’adénosine  monophosphate  
E. Le  même  type  de  réaction  permet  l’activation  des  acides  aminés  
 
 
La  voie  métabolique  conduisant  du  tryptophane  à  la  mélatonine  dans  les  cellules  figure  ci-­‐dessous.  
 

 

Tryptophane

5-hydroxy-tryptophane

Réaction 1

5-hydroxy-tryptamine

Réaction 2

Mélatonine
Réaction 3
N-acétyl-hydroxy-tryptamine

 
16.  Indiquez  si  les  propositions  suivantes  concernant  cette  voie  métabolique  sont  vraies  ou  fausses.  
A. La  réaction    est  une  réaction  de  réduction  
B. La  réaction  s’accompagne  de  l’élimination  de  dioxyde  de  carbone  
C. La  réaction  ‚s’accompagne  de  la  formation  d’eau  
D. La  réaction  ‚est  une  réaction  de  transfert  
E. La  réactionƒest  une  réaction  de  transfert  
 
17.  Indiquez  si  les  propositions  suivantes  concernant  les  coenzymes  impliqués  sont  vraies  ou  fausses.  
A. Le  coenzyme  nécessaire  à  la  réaction  ‚est  le  tétrahydrofolate  
B. Le  coenzyme  nécessaire  à  la  réaction  ‚  est  le  coenzyme  A  
C. Le  coenzyme  nécessaire  à  la  réaction  ƒ  est  la  S-­‐adénosyl  méthionine  
D. Le  coenzyme  nécessaire  à  la  réaction  ƒ  est  le  pyridoxal  phosphate  
E. Le  coenzyme  nécessaire  à  la  réaction  ƒ  est  la  thiamine  pyrophosphate  
 
 

Le  glutathion  (G)  est  le  principal  thiol  intracellulaire.  Sa  structure  est  la  suivante  :  
 

 
 

 

25  

 
18.  Indiquez  si  les  propositions  suivantes  concernant  le  Glutathion  sont  vraies  ou  fausses.  
A. Le  glutathion  est  un  coenzyme  de  transfert  de  fonction  thiol  
B. La  réactivité  du  glutathion  résulte  de  la  présence  de  la  fonction  thiol  
C. Le  glutathion  peut  exister  sous  forme  de  dimère  
D. Le  glutathion  est  la  γ-­‐L-­‐glutamyl-­‐L-­‐cystéinylglycine  
E. Le  glutathion  oxydé  peut  se  représenter  sous  la  forme  G-­‐SO2  
 
19.  Indiquez  si  les  propositions  suivantes  concernant  le  Glutathion  sont  vraies  ou  fausses.  
A. Le  glutathion  est  une  molécule  amphotère  
B. En  solution  aqueuse,  le  glutathion  peut  se  trouver  sous  cinq  formes  ioniques  distinctes  
C. Le  pH  isoélectrique  du  glutathion  a  pour  valeur  2,82  
D. Le  pH  isoélectrique  du  glutathion  a  pour  valeur  5,39  
E. Le  pH  isoélectrique  du  glutathion  a  pour  valeur  6,57  
 
 
20.  Indiquez  si  les  propositions  suivantes  concernant  la  molécule  ci-­‐dessous  sont  vraies  ou  fausses.  
NH2
N

N
O
O

P

OH
O

P

OH
H3C

N

N
O

O

O

CH3

H2O3P O OH

HO
NH
O

NH
O

 
A.
B.
C.
D.
E.

S

CH3
O

 

Elle  possède  un  résidu  3’-­‐5’diphosphoadénosine  
Elle  possède  cinq  carbones  asymétriques  
Elle  possède  deux  liaisons  de  type  anhydride  
La  liaison  S-­‐acyl  est  une  liaison  de  type  thio-­‐éther  
Elle  dérive  de  l’acide  pantothénique  

 
21.  Concernant  le  composé  ci-­‐dessus,  préciser  si  les  propositions  suivantes  sont  vraies  ou  fausses.  
A. Il  est  chargé  négativement  à  pH  7,4  
B. Il  dérive  d’une  structure  vitaminique  qui  est  la  riboflavine  
C. Il  participe  à  des  réactions  d’oxydo-­‐réduction  
D. Il  intervient  au  cours  des  réactions  de  transfert  de  groupement  méthyle  
 
 

 

 

26  

 
Acides  nucléiques  
 
 
1.  Parmi  les  formules  suivantes,  quelle  est  celle  de  la  cytosine  ?  
A. O
B.
C.
D.
O
NH2
HN
O

N

HN
N
H

H2N

N

N
H

N
O

N

N
N
H

E.

NH2

N

N
H

O
CH3

HN
O

N
H

 
 
2.  Indiquez  si  les  propositions  suivantes  concernant  la  liaison  entre  la  cytosine  et  le  désoxyribose  dans  une  
molécule  d’ADN  sont  vraies  ou  fausses.  
A. La  liaison  s’effectue  entre  le  carbone  1’  du  désoxyribose  et  l’azote  1  de  la  cytosine.    
B. La  liaison  s’effectue  entre  le  carbone  1’  du  désoxyribose  et  l’azote  9  de  la  cytosine.    
C. Il  s’agit  d’une  liaison  phosphodiester.  
D. Il  s’agit  d’une  liaison  β-­‐N-­‐osidique.  
E. Elle  est  hydrolysable.  
 
3.  Identifiez  les  bases  et  les  oses  des  nucléosides  suivants  :  

 
 
4.  Indiquez  si  les  propositions  suivantes  concernant  les  polynucléotides  sont  vraies  ou  fausses.  
A. Ils  comportent  des  liaisons  phosphodiester  
B. Par  convention,  leur  écriture  s’effectue  dans  le  sens  5’  vers  3’  
C. L’extrémité  3’  comporte  un  groupement  phosphate  
D. Dans  un  polynucléotide  circulaire,  aucun  ose  ne  présente  un  groupe  -­‐OH  libre  en  3’.  
E. Ils  comportent  des  charges  négatives  à  pH  =  7  provenant  des  groupements  phosphates  ionisés.  
 
5.  Précisez  si  les  propositions  suivantes  concernant  l’ADN  sont  vraies  ou  fausses.  
A. Les  2  brins  d’ADN  sont  antiparallèles  car  le  plan  des  bases  est  perpendiculaire  à  l’axe  
B. Les   2   chaînes   sont   complémentaires   en   raison   d’interactions   entre   les   sucres   et   les   phosphates   des  
2  chaînes  
C. Le  motif  de  base  d’un  brin  d’ADN  est  un  nucléotide  
D. Dans  une  molécule  d’ADN,  la  somme  (A  +  T)  est  toujours  égale  à  la  somme  (G  +  C)  
E. Lors  de  la  synthèse  d’un  acide  nucléique,  la  liaison  phosphodiester  se  fait  entre  l’extrémité  5’P  d’un  
nucléotide  et  le  3’OH  d’un  autre  nucléotide  
 
6.  Indiquez  si  les  propositions  suivantes  concernant  la  réplication  sont  vraies  ou  fausses.  
A. La  réplication  de  l'ADN  est  semi-­‐conservative    
B. Les  ADN  polymérases  ne  peuvent  réaliser  la  synthèse  que  dans  le  sens  de  l’élongation  3'  >  5'    
C. L'orientation  anti-­‐parallèle  des  deux  brins  matrice  impose  un  système  de  synthèse  discontinu    
D. L’ADN  polymérase  corrige  toutes  les  erreurs  commises  pendant  la  synthèse    
E. Les   fragments   d'Okasaki   sont   de   courts   segments   d’ADN   qui   servent   d'amorces   aux   segments  
d’ADN  sur  le  brin  retardé.  
 

 

27  

 
7.   Indiquez   si   les   propositions   suivantes   concernant   la   transcription   des   gènes   eucaryotes   sont   vraies   ou  
fausses.  
A. La  transcription  se  déroule  dans  le  noyau  de  la  cellule    
B. Elle  nécessite  l'action  d'une  ADN  polymérase    
C. Elle  est  initiée  par  l'hybridation  d'une  amorce  sur  la  région  promotrice    
D. Elle  débute  toujours  sur  une  région  promotrice  située  en  amont  des  unités  de  transcription    
E. Elle  conduit  à  la  formation  de  hnARN  (pré-­‐ARNm)  
 
8.  Indiquez  si  les  propositions  suivantes  concernant  l'épissage  sont  vraies  ou  fausses.  
A. L’épissage  nécessite  l'intervention  d'exonucléases    
B. L’épissage  se  déroule  dans  le  cytoplasme    
C. L’épissage  permet  d’éliminer  les  exons  du  hnARN    
D. L’épissage  nécessite  deux  réactions  successives  de  trans-­‐estérification    
E. L’épissage  fait  intervenir  des  snARN  s’assemblant  au  sein  du  spliceosome  
 
9.  Indiquez  si  les  propositions  suivantes  concernant  les  aminoacyl  ARNt  synthétases  sont  vraies  ou  fausses.  
A. Elles  associent  les  acides  aminés  aux  ARN  de  transfert    
B. Elles  reconnaissent  les  ARNt  par  la  séquence  de  leur  anticodon    
C. Elles  sont  garantes  de  la  fidélité́  de  la  traduction    
D. Elles  permettent  la  synthèse  des  ARN  de  transfert    
E. Elles  assurent  la  création  de  la  liaison  peptidique  dans  la  synthèse  des  polypeptides    
 
10.  Indiquez  si  les  propositions  suivantes  concernant  la  traduction  sont  vraies  ou  fausses.  
A. La  traduction  est  initiée  par  la  liaison  de  facteurs  protéiques  sur  la  région  promotrice  du  gène    
B. L’activité  peptidyl-­‐transférase  est  portée  par  la  petite  sous-­‐unité  du  ribosome    
C. Chaque  nouvel  acide  aminé  est  transféré  sur  la  chaîne  peptidique  en  cours  de  synthèse    
D. Il  existe  un  système  de  réparation  en  cas  de  synthèse  incorrecte  de  la  chaîne  peptidique    
E. La  traduction  d’un  gène  se  déroule  toujours  à  la  même  vitesse  dans  une  cellule    
 
 
 
11.  Soit  le  composé  dont  la  structure  est  la  suivante  :  
 
NH2
N
B)
A)

H2N

O

R

O
O

 
 
 



O

O
C)

 

 





P

N

N

OH

D)
N

Identifier  les  différents  composants  :  A),  B),  C)  et  D)    
Identifier  les  liaisons  qui  les  unissent.  
Quel  est  le  nom  de  ce  composé  ?  
Ce  composé  est  un  intermédiaire  pour  une  étape  indispensable  à  la  synthèse  protéique  Quelle  est  
cette  étape  ?  
Par  quel  enzyme  ce  composé  est-­‐il  pris  en  charge  ?  
 
 

28  

 
Une  protéine  P  est  exprimée  à  la  surface  de  cellules  eucaryotes.  La  séquence  de  l’ARNm  codant  pour  
l’extrémité  N  terminale  de  cette  protéine  est  la  suivante  :                5’  AUG  GGU  AAU  GAU  GCU  …  
3’  
 
12.   Parmi   les   propositions   suivantes   qui   concernent   l’anticodon,   quelle(s)   est(sont)   la(les)   proposition(s)  
exacte(s)  ?  
A. La  séquence  du  brin  d’ADN  sens  correspondant  est  :  5’  ATG  GGT  AAT  GAT  GCT  …  3’  
B. La  séquence  du  brin  d’ADN  sens  correspondant  est  :  5’  TAC  CCA  TTA  CTA  CGA  …  3’  
C. La  séquence  peptidique  de  cette  extrémité  N  terminale  est  :  NH2  –  Ala  –  Asp  –  Asn  –  Gly  –  Met  -­‐  …  
D. La  séquence  peptidique  de  cette  extrémité  N  terminale  est  :  NH2  –  Met  –  Gly  –  Asn  –  Asp  –  Ala  -­‐  …  
E. La  séquence  peptidique  de  cette  extrémité  N  terminale  est  :  HOOC  -­‐  Met  –  Gly  –  Asn  –  Asp  –  Ala  -­‐  …  
 
13.   Parmi   les   propositions   suivantes   qui   concernent   l’anticodon,   quelle(s)   est(sont)   la(les)   proposition(s)  
exacte(s)  ?  
A. C’est  un  triplet  de  nucléotide  
B. C’est  une  région  particulière  d’un  ARN  ribosomal  
C. Il  est  complémentaire  du  codon  
D. Il  est  porté  par  l’ARNm  
E. A  un  anti-­‐codon  ne  correspond  qu’un  acide  aminé  
 
14.   Parmi   les   propositions   suivantes,   laquelle   correspond   à   la   séquence   de   l’anticodon   du   second   acide  
aminé  ?  
A. 3’  ACC  5’  
B. 5’  UGG  3’  
C. 5’  AAU  3’  
D. 5’  ACC  3’  
E. 3’  UGG  5’  
 
 
Parmi  les  diabètes  de  type  II,  se  trouvent  les  diabètes  dits  MODY  (Maturity  Onset  type  Diabetes  of  
the   Young).   Les   diabètes   MODY   sont   des   maladies   monogéniques   (c'est-­‐à-­‐dire   causées   par   la   mutation   d'un  
gène).  Dans  le  cas  du  diabète  MODY-­‐2  c’est  le  gène  de  la  glucokinase  qui  est  muté.  
Le   gène   de   la   glucokinase   a   été   cloné   :   il   code   pour   une   protéine   de   465   acides   aminés.   Une  
mutation  représentée  ci-­‐contre  (brin  sens)  a  été  trouvée  chez  des  individus  atteints  de  diabète  MODY-­‐2.    
 
gène  glucokinase    
(832)     GAC  GAG  AGC  TCT      (843)  
glucokinase  normale  
 
Asp      Glu      Ser      Ser  
gène  muté  MODY-­‐2    
(832)     GAC  TAG  AGC  TCT      (843)  
 
15.  Précisez  si  les  propositions  suivantes  sont  vraies  ou  fausses.  
A. La  mutation  concerne  l’acide  aminé  278      
B. Le  triplet  muté  sur  l’ARNm  est  CAU  
C. La  mutation  est  une  mutation  faux  sens  
D. La  mutation  est  une  mutation  non  sens  
E. Cette  mutation  affecte  probablement  l’activité  biologique  de  la  glucokinase  
 
16.   D’autres   mutations   ponctuelles   ont   été   décrites.   Précisez   si   les   propositions   suivantes   sont   vraies   ou  
fausses.  
A. La  mutation  c.1160C>T  (p.Ala387Val)  est  une  mutation  non  sens  
B. La  mutation  c.1159G>A  (p.Ala387Thr)  est  une  mutation  faux  sens  
C. Les  mutations  de  la  3ème  base  de  ce  codon  seront  toutes  silencieuses  
D. On  peut  envisager  d’autres  mutations  pour  la  base  1158,  3ème  base  de  ce  codon  
E. La  double  mutation  c.1159_1160GC>AT  pourrait  aboutir  à  un  codon  stop  
 
 

 

29  

17.  L’acide  aspartique  78  de  la  glucokinase  peut  être  remplacé  par  une  histidine  ou  un  acide  glutamique.  
Précisez  si  les  propositions  suivantes  sont  vraies  ou  fausses.  
A. La  mutation  Asp  →  His  est  susceptible  de  modifier  la  structure  tertiaire  
B. La  mutation  Asp  →  Glu  correspond  à  une  mutation  ponctuelle  de  la  3ème  base  du  codon  
C. La  mutation  Asp  →  His  correspond  à  une  mutation  ponctuelle  de  la  1ère  base  du  codon  
D. Une  mutation  Asp  →  Phe  peut  résulter  d’une  mutation  ponctuelle  
E. Si  les  mutations  de  Asp  78  sont  à  l’origine  de  diabète  MODY-­‐2,  le  malade  qui  présente,  a  priori  la  
forme  la  plus  bénigne  est  celui  qui  a  la  mutation  Asp  →  His  
 
 
Actuellement,   une   quarantaine   d’altérations   ont   été   identifiées   dans   le   gène   de   la   peroxydase  
thyroïdienne   chez   des   patients   souffrant   d’hypothyroïdie   congénitale   liée   à   un   défaut   d’organification   de  
l’iode.  Deux  altérations  (insertions)  ont  été  décrites.  Dans  les  deux  cas  il  y  a  un  décalage  du  cadre  de  lecture  
qui  génère  un  signal  stop  prématuré.  
L’insertion  du  tétranucléotide  GGCC  en  position  1226  dans  l’exon  8  est  illustrée  ci-­‐dessous  :  
Ø séquences  partielles  des  exons  8  et  9  (lettres  majuscules)  et  de  l’intron  8  (lettres  minuscules).    
Ø la  séquence  de  la  protéine  figure  au  dessus  en  symbole  unilittéraux.    
 

 
 
Des   fragments   d’ADN   génomique   sont   amplifiés   par   PCR,  
coupés   par   l’enzyme   NaeI   (GCC↓GGC),   puis   analysés   par  
électrophorèse.  
La   séquence   d’une   amorce   de   la   PCR   est  :  
TCCACCGTGTATGGCAGCTC.  
                       Le  résultat  de  l’électrophorèse  est  présenté  ci-­‐contre.  

 
 
 
 
 
 
 
 
 
 
 
 

 

18.  Précisez  si  les  propositions  suivantes  sont  vraies  ou  fausses.  
A. Le  site  reconnu  par  une  enzyme  de  restriction  est  généralement  de  nature  palindromique  
B. Les  enzymes  de  restriction  appartiennent  à  la  classe  des  hydrolases  
C. La  séquence  amorce  reconnaît  20  bases  à  partir  du  nucléotide  1019  
D. La  séquence  amplifiée  correspond  à  un  fragment  des  exons  8  et  9  
E. Le  triplet  placé  sous  l’astérisque  correspond  à  un  signal  STOP  
 

 

30  

19.  Précisez  si  les  propositions  suivantes  sont  vraies  ou  fausses.  
A. La  coupure  par  l’enzyme  NaeI  génère  des  extrémités  cohésives  
B. Le  fragment  de  250  paires  de  bases  correspond  à  l’extrémité  5’  du  fragment  initial  
C. Si   l’insertion   se   faisait   dans   un   dinucléotide   GC,   cela   génèrerait   un   site   de   coupure   par   SmaI  
(CCC↓GGG)  
D. Une  insertion  dans  un  intron  ne  peut  pas  modifier  l’épissage  
E. Une  insertion  dans  un  intron  est  généralement  moins  dommageable  qu’une  insertion  dans  un  exon  
 
20.  Précisez  si  les  propositions  suivantes  sont  vraies  ou  fausses.  
A. Le  codon  stop  prématuré  peut  se  trouver  indifféremment  dans  un  exon  ou  un  intron  
B. Toute  insertion  d’un  nombre  pair  de  bases  amène  à  un  décalage  du  cadre  de  lecture  
C. Un   décalage   du   cadre   de   lecture   peut   aboutir   à   une   protéine   de   taille   supérieure   à   la   protéine  
normale  
D. Un   décalage   dans   la   partie   du   messager   correspondant   à   la   partie   N-­‐terminale   de   la   protéine   est  
potentiellement  plus  dommageable  
E. Un  décalage  du  cadre  de  lecture  peut  modifier  la  localisation  cellulaire  de  la  protéine  
 
 
Concours  2011-­‐2012  :  
 
Le   cycle   de   l’acide   citrique,   communément   appelé   cycle   de   Krebs,   est   une   étape   importante   du  
métabolisme   qui   permet   à   la   cellule   de   produire   de   l’énergie   et   des   coenzymes   sous   forme   réduite.   Les  
isocitrates   déshydrogénases   jouent   un   rôle   important   dans   ce   cycle.   Elles   catalysent   la   transformation   de  
l’isocitrate  en  α-­‐cétoglutarate.  
Cette   réaction   peut   être   catalysée   par   plusieurs   enzymes   codées   par   des   gènes   différents.   Chez  
l’homme,  3  enzymes  sont  capables  de  catalyser  cette  réaction  :  IDH1,  IDH2  et  IDH3.  
 
Le  gène  IDH1  est  localisé  sur  le  chromosome  22.  Il  comporte  10  exons,  et  code  pour  une  protéine  de  414  
acides   aminés.   La   séquence   de   l’exon   4   est   présentée   ci-­‐dessous,   entourée   des   extrémités   des   introns   qui  
l’encadrent  (lettres  minuscules).  
 

 
               373  
 
                 ↓  
cacgtgagtggatgggtaag  CTT  AAA  ACT  ATC  ATC  ATA  GGT  CGT  CAT  GCT  TAT  GGG  GAT  CAA  GTA  AGA  CAT  GTT  
GGC  AAT  AAT  GTG  ATC  TTA  TTA  TTA  gtctctctgcaggcaaaaac  
 
21.  Indiquez    si  les  propositions  suivantes  concernant  le  gène  IDH1  et  son  ARNm  sont  vraies  ou  fausses.  
A. L’ARNm  IDH1  comporte  1242  nucléotides  
B. La  protéine  IDH1  débute  par  une  proline  
C. Le  gène  IDH1  comporte  9  introns  
D. L’ARNm  codant  pour  la  protéine  IDH1  est  synthétisé  à  partir  du  brin  sens  du  gène.  
E. Le  début  de  la  séquence  présentée  correspond  à  l’extrémité  3’  de  l’intron  4  
 
Des   formes   mutées   du   gène   IDH1   ont   été   décrites   dans   certaines   tumeurs.   L’altération   la   plus  
fréquemment   rencontrée   dans   les   cellules   cancéreuses   est   la   mutation   p.R132H.   Cette   altération   est  
retrouvée  dans  l’exon  4  du  gène  IDH1.  
 
22.  Indiquez  si  les  propositions  suivantes  concernant  la  mutation  rencontrée  sont  vraies  ou  fausses.  
A. Il  s’agit  d’une  substitution  
B. Il  s’agit  d’une  insertion  
C. Elle  va  modifier  le  mécanisme  d’épissage  
D. La  mutation  c.419G>A  est  compatible  avec  l’altération  retrouvée  au  niveau  protéique  
E. La  mutation  c.395G>A  est  compatible  avec  l’altération  retrouvée  au  niveau  protéique  
 
 

 

31  

L’existence   de   la   mutation   peut   également   être   recherchée   au   niveau   moléculaire.   L’ADN   doit   être  
extrait   à   partir   du   tissu   tumoral   et   une   partie   du   gène   IDH1   est   amplifiée   par   PCR.   La   séquence   de   ce  
fragment  est  redonnée  ci-­‐dessous  :  
 
cacgtgagtggatgggtaag  CTT  AAA  ACT  ATC  ATC  ATA  GGT  CGT  CAT  GCT  TAT  GGG  GAT  CAA  GTA  AGA  CAT  GTT  
GGC  AAT  AAT  GTG  ATC  TTA  TTA  TTA  gtctctctgcaggcaaaaac  
 
23.  Précisez  si  les  propositions  suivantes  concernant  l’amplification  d’ADN  par  PCR  sont  vraies  ou  fausses.  
A. L'ADN  polymérase  ajoute  des  nucléotides  sur  le  brin  en  croissance  de  3’  vers  5’  
B. L’ADN  polymérase  thermorésistante  (Taq  polymérase)  provient  d’une  bactérie  
C. La  région  d’ADN  indiquée  ci-­‐dessus  peut  être  amplifiée  avec  les  amorces  :    
CACGTGAGTGGATGGGTAAG  et  GTCTCTCTGCAGGCAAAAAC  
D. La  région  d’ADN  indiquée  ci-­‐dessus  peut  être  amplifiée  avec  les  amorces  :    
CACGTGAGTGGATGGGTAAG  et  GTTTTTGCCTGCAGAGAGAGC  
E. Le  couple  d’amorces  ci-­‐dessous  permet  d’amplifier  une  partie  de  la  séquence  présentée  
CTTAAAACTATCATCATAGG  et  GTTTTTGCCTGCAGAGAGAGC  
 
Plusieurs  techniques  peuvent  être  utilisées  pour  mettre  en  évidence  cette  mutation  ponctuelle.  Une  des  
techniques   les   plus   sensibles   est   basée   sur   la   nécessité   d’un   appariement   complet   à   l’extrémité   3’   des  
amorces  de  PCR.  La  technique  est  appelée  PCR  spécifique  d’allèle.  
2  réactions  de  PCR  sont  réalisées  pour  chaque  échantillon  :  
§ La   PCR   (A)   est   effectuée   en   présence   de   l’amorce   sens   AACTATCATCATAGGTCG   et   d’une   amorce  
anti-­‐sens  située  sur  le  même  exon  
§ La   PCR   (B)   est   effectuée   en   présence   de   l’amorce   sens   AACTATCATCATAGGTCA   et   de   la   même  
amorce  anti-­‐sens  que  la  PCR  (A)  
 
Une   série   de   tumeurs   cérébrales   a   été   analysée   par   cette   technique.   Les   produits   de   PCR   ont   été  
analysés  par  électrophorèse  en  gel  d’agarose.  La  figure  ci-­‐dessous  présente  les  résultats  obtenus.  
 

1 2 3 4 5 6 7 8 9 10
A
B
 
 
 
24.  Indiquez  si  les  propositions  suivantes  sont  vraies  ou  fausses.  
A. L’agarose  utilisé  pour  former  le  gel  est  un  polymère  contenant  du  galactose  
B. Les  fragments  d’ADN  sont  séparés  en  fonction  de  leur  taille  
C. Les  acides  nucléiques  se  déplacent  dans  le  champ  électrique  grâce  aux  charges  positives  des  bases  
azotées  
D. Les  fragments  d’ADN  amplifiés  avec  l’amorce  A  ou  l’amorce  B  ont  la  même  taille  
E. Les   fragments   d’ADN   peuvent   être   détectés   après   séparation   électrophorétique   en   utilisant   un  
agent  intercalant  
 
 

 

 

32  

 
25.  Indiquez  si  les  propositions  suivantes  concernant  les  résultats  obtenus  sont  vraies  ou  fausses.  
A. La  tumeur  N°1  ne  présente  pas  la  mutation  recherchée  
B. La  tumeur  N°2  ne  présente  pas  la  mutation  recherchée  
C. La  tumeur  N°4  présente  la  mutation  recherchée  à  l’état  homozygote  
D. Les  résultats  obtenus  permettent  de  conclure  que  la  tumeur  N°7  n’exprime  pas  le  gène  IDH1  
E. La  majorité  des  tumeurs  étudiées  présentent  la  mutation  recherchée  
 
Une   expérience   similaire   aurait   pu   être   réalisée   à   partir   d’ADNc   synthétisé   à   partir   d’ARNm,   puis  
amplifié  dans  les  mêmes  conditions  que  précédemment.  
 
26.  Indiquez  si  les  propositions  suivantes  sont  vraies  ou  fausses.  
A. La  transcriptase  inverse  est  une  ARN  polymérase  
B. La  transcriptase  inverse  est  exprimée  par  les  rétrovirus  
C. La  transcriptase  inverse  ne  nécessite  pas  d’amorce  
D. A   partir   d’un   même   nombre   de   cellules,   la   quantité   d’ADNc   cible   sera   plus   importante   que   la  
quantité  d’ADN  génomique  cible  
E. Les   résultats   obtenus   auraient   été   similaires   à   ceux   présentés   sur   la   figure   pour   les   échantillons   1   à  
6  
 
 
 
 
 
 
 
 
Code  génétique  
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
Code  unilittéral  
Ala   Arg   Asn   Asp   Cys   Gln   Glu   Gly   His   Ile   Leu   Lys   Met   Phe   Pro   Ser   Thr   Trp   Tyr   Val  
A   R   N   D   C   Q   E   G   H   I   L   K   M   F   P   S  
T   W   Y   V  
 

 

 
 
 

 

33  


Documents similaires


Fichier PDF examens biologie cell
Fichier PDF polycopie bioch metab ii chap iii 3e a lf 2015 2016
Fichier PDF cours bioch metab ii chap iii 3e a lf isbm 2015 2016
Fichier PDF ex examen bioch structurale elts de reponses
Fichier PDF glossaire
Fichier PDF peptides planches 2015


Sur le même sujet..